Question

Which of the following oligonucleotides has the highest Tm when annealed to their complementary strands of...

Which of the following oligonucleotides has the highest Tm when annealed to their complementary strands of DNA?

A) GGAACCCAAGCGCTTAGC

B) GAACCAAGCTTTAGC

C) GGACCCAGCGCTAGC

D) ATTATTCAAATGGATTA

0 0
Add a comment Improve this question Transcribed image text
Answer #1

GGAACCCAAGCGCTTAGC (option A) oligonucleotides has the highest Tm when annealed to their complementary strands of DNA

explanation :- because this oligonucleotide contain highest GC content and higher the number of GC bases highest the Tm.

melting temperature can be calculated by formula

Tm=4(G+C) + 2(A+T)

Add a comment
Know the answer?
Add Answer to:
Which of the following oligonucleotides has the highest Tm when annealed to their complementary strands of...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Please show all work and answer all parts of the question. Thanks 3. When self-complementary strands...

    Please show all work and answer all parts of the question. Thanks 3. When self-complementary strands of DNA are mixed, they form a double-stranded DNA at low temperatures but dissociate to single strands as the temperature is raised: T(C) A (oligoA-T) This can be observed by an increase in the absorbance of the solutions at 260 nm (The double helix is said to show "hypochromicity" at this wavelength) 10 15 20 25 30 35 40 45 50 0.720 0.732 0.740...

  • or d. transposons refers to short DNA or RNA sequences, termed oligonucleotides, which are designed to...

    or d. transposons refers to short DNA or RNA sequences, termed oligonucleotides, which are designed to be complementary to a specific gene sequence. a. sense b. antisense C. Template DNA

  • Which of the following is true? a. The two strands of a DNA molecule are held...

    Which of the following is true? a. The two strands of a DNA molecule are held together by covalent bonds. b. Hydrogen bonding between complementary base pairs causes the DNA molecule to twist into a spiral. c. A single strand within a DNA molecule is held together by hydrogen bonds. d. The bases on one strand of DNA are held to the bases on the other strand by hydrogen bonds.

  • How DNA Is Copied 4. What does it mean that the two strands of DNA are...

    How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...

  • Two complementary strands of DNA can exist in solution in the form of a duplex (double-stranded...

    Two complementary strands of DNA can exist in solution in the form of a duplex (double-stranded form) or can exist as separate strands ("random coils"), depending on the position of the equilibrium shown below. Double-stranded form < = = > single strands ("random coil") With regard to Enthalpy and Entropy, match the interactions that favor the form of DNA listed. What is the enthalpic term favoring single stranded DNA? A. Hydrogen Bonding B. Conformational C. Base Stacking D. van der...

  • Justify the answers please 1. Rank the following DNA fragments by Tm, lowest to highest (5...

    Justify the answers please 1. Rank the following DNA fragments by Tm, lowest to highest (5 pts) i. GATATATATTITATAAAATATTAC ii. TGCGCCGGCCGCGCCCCCCCGCGA iii.GATATATAGCGCCATAAGCTATTA 2. A 20-year-old anemic man is found to have an abnormal form of B-globin that has 172 amino acids, rather than the 141 found in the normal protein. Which of the following point mutations is consistent with this abnormality (5 pts)? A, TAA → CAA B.CGA-. TGA C.TAA → TAG D.GAT. → GAC 3. Describe how E. coli...

  • Heat can disrupt hydrogen bonding between DNA strands, causing denaturation. Which of the following DNA strands...

    Heat can disrupt hydrogen bonding between DNA strands, causing denaturation. Which of the following DNA strands would have the HIGHEST denaturation temperature considering the different number of base pairs between the various bases? 10% AT and 90% GC 90% AT and 10% GC 50% AT and 50% GC 70% AT and 30% GC 30% AT and 70% GC

  • 1a. Which of the following DNA strands, the top or bottom, would serve as a template...

    1a. Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction? 5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′ 3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′ ⎯⎯⎯⎯→ Direction of DNA unwinding b. What would be the resulting RNA sequence (written 5′→3′ )? 2. You have learned about the events surrounding DNA replication and the central dogma. Identify the steps associated with these processes that would be adversely affected in the...

  • 1 Which of the following represents one of the mechanisms by which antisense agents exert their...

    1 Which of the following represents one of the mechanisms by which antisense agents exert their effect? a. A short DNA sequence binds to specific regions of complementary mRNA, inducing a nuclease that promotes translation to the corresponding protein b. Antisense oligonucleotides prevent the natural silencing of targeted mRNA sequences C. A short DNA sequence binds to specific regions of complementary mRNA, inducing a nuclease that cleaves the mRNA d. Antisense oligonucleotides inhibit all types of gene splicing 2 The...

  • For the following DNA strand: ATTTTAAGCTAAGCTCCA (a) Write the complementary strand, (b) Calculate the number of...

    For the following DNA strand: ATTTTAAGCTAAGCTCCA (a) Write the complementary strand, (b) Calculate the number of hydrogen bonds existing between the strands, (c) Specify the 5’ and 3’ ends for each strand.

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT