If you were asked to design PCR primers to amplify this gene, provide in the space below the sequences (5’ à 3’) of both the forward and reverse (sense and antisense) primers required to amplify the gene. Design your primers to be exactly 15 bases in length each. Design them so that the forward primer extreme 5’ end matches up with the extreme end of the start codon, and the reverse primer extreme 5’ end matches up with the extreme end of the stop codon.
Forward 5’ à 3’ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___
Reverse 5’ à 3’ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___
2572201 aaaaatagtt tacgatcgta aaaatctgca tatcatgata agagtggtta cattgccacg
2572261 ctgcttaacc cgccgatgcg cgggtttttt tgtacccaga atcctgtgag ctatacggaa
2572321 agtacacaga aaggaaggtg cgaccacaat taataacaaa atcttaaaaa ttgcacatgg
2572381 cactattagt tttctaaata ttgtgtattt tttgtattgc aggatgaccc tgtaacgaag
2572441 tttgcgtaac agcattttgc tctacgagtt tgccagcctc ccccagtggc tggctttttt
2572501 atgtccgtaa catcctgtgt atcaataaat gttgttgtct acgtacgtca agtagtcgca
2572561 tgagatctga ccagatatgt taaggttgca gctctctttg aatataatta tcattttcat
2572621 tacgttattg ttacgtttat ccggtgcgcc gtaaaacgcc gtccttcagg gggtggagga
2572681 tgtcaagaat atagttatcg tatggtgctc aaggagtatt gtgtaatatg aaaataatta
2572741 tttttagagt gctaactttt ttctttgtta tcttttcagt taatgtggtt gcgaaggaat
2572801 ttaccttaga cttctcgact gcaaagacgt atgtagattc gctgaatgtc attcgctctg
2572861 caataggtac tccattacag actatttcat caggaggtac gtctttactg atgattgata
2572921 gtggcacagg ggataatttg tttgcagttg atgtcagagg gatagatcca gaggaagggc
2572981 ggtttaataa tctacggctt attgttgaac gaaataattt atatgtgaca ggatttgtta
2573041 acaggacaaa taatgttttt tatcgctttg ctgatttttc acatgttacc tttccaggta
2573101 caacagcggt tacattgtct ggtgacagta gctataccac gttacagcgt gttgcaggga
2573161 tcagtcgtac ggggatgcag ataaatcgcc attcgttgac tacttcttat ctggatttaa
2573221 tgtcgcatag tggaacctca ctgacgcagt ctgtggcaag agcgatgtta cggtttgtta
2573281 ctgtgacagc tgaagcttta cgttttcggc aaatacagag gggatttcgt acaacactgg
2573341 atgatctcag tgggcgttct tatgtaatga ctgctgaaga tgttgatctt acattgaact
2573401 ggggaaggtt gagtagtgtc ctgcctgatt atcatggaca agactctgtt cgtgtaggaa
2573461 gaatttcttt tggaagcatt aatgcaattc tgggaagcgt ggcattaata ctgaattgtc
2573521 atcatcatgc atcgcgagtt gccagaatgg catctgatga gtttccttct atgtgtccgg
2573581 cagatggaag agtccgtggg attacgcaca ataaaatatt gtgggattca tccactctgg
2573641 gggcaattct gatgcgcaga actattagca gttgaggggg taaaatgaaa aaaacattat
2573701 taatagctgc atcgctttca tttttttcag caagtgcgct ggcgacgcct gattgtgtaa
2573761 ctggaaaggt ggagtataca aaatataatg atgacgatac ctttacagtt aaagtgggtg
2573821 ataaagaatt atttaccaac agatggaatc ttcagtctct tcttctcagt gcgcaaatta
2573881 cggggatgac tgtaaccatt aaaactaatg cctgtcataa tggaggggga ttcagcgaag
2573941 ttatttttcg ttgacttaga atagctcagt gaaaatagca ggcggagatt cataaatgtt
2574001
Forward Primer: 5’ aatctgcatatcatg 3’
Reverse primer: 5’ ttatgaatctccgcc 3’
Since start codon is AUG, so while designing the forward primer we need to focus on first finding the very first ATG in the sequence. We can design primers including this region in primer.
Similarly while designing reverse primer for the sequence we need to find the lastest of either TAA, TGA, or TAG which are corresponding sequences of UAA, UGA or UAG respectively as stop codons.
These sequences have been highlighted in the
picture below.
If you were asked to design PCR primers to amplify this gene, provide in the space...
1. Create the primers to amplify the gene of interest. 1. Below is almost the full sequence of the coding strand of the F9 gene (exon 2-exon4) that you found in the online database (NCBI, Genomic sequence F9 gene). Some of the sequence is missing, but you know how many nucleotides are skipped. Design forward and reverse primers 18nt each for PCR that will isolate EXACTLY the sequence that is in bold typeface. Exon 2 = 164 nt Intron 2...
To do the PCR, we used 2 universal primers that roughly match sequences near the 5’ and 3’ ends of the 16S rRNA gene. The forward primer binds near the 5’ end to the complementary strand of the sequences shown below. The sequence of the forward primer is: Agagtttgatcctggctcag The reverse primer binds near the 3’ end to the sequences shown below. The sequence of the reverse primer is: ACGGCTACCTTGTTACGACTTG To find the primer in the sequence below, you must...
need help with this
Tm: Tm: 16. You wish to amplify the DNA fragments below and add cut sites for subsequent cloning. Design both primers with the restriction enzymes cut sites listed, and add two overhang bases to each primer. Label the extra bases and cut sites. Each primer should be 14 nucleotides in length. a. 5'-CTATGAGGTCCTGCGTTAGTGTTACC-3' Forward: 5'- 5' EcoRI, 3' BamHI, overhang bases Reverse: 5'- Annealing Temperature: b. 5'- CCTGGGTGTTACATGCCATTAGCGTT-3' Forward: 5'- Tm: 5' HindiII, 3' Sphl, overhang...
Can you answer and explain it please
Q. You want to PCR amplify the underlined/bold DNA fragment. Design two primers for this job. The size of each primer is 18 bp -3 Forward primer: 5'- Reverse primer: 5'-( ATGACTATAGGGAACACTACGAGTGTGACAACGGTACGTAAC GCGGCGATCGAGCG ACCGAA GCTACTCCGCCTTTAGCTCTCGACAAT ATCGACGCCGCTA CGGATGTGTTTAGGCCTGGT GA TGCTGG AACCCTTTA TTCGCCGAGGAAG ATGTTATCAGCGGGTCTATCAGCATCA CGATCATCGTGAGCT GGTTCTTGGCTATTTCGGAGCAGGT GTCGAATCCGATGCT ITTGTGGGTGAGATGGGTTTATTCA GTGAAGTC ATCTTACGTACACGGA ACTCAGTGTGAATTGG AAGGC AGTTTAGCGAGTGATGCGCCGCGGATTTTGTATGCGATAGGTAT GCAGTTATCTAAGCGTTTATTGCTTACCAC
Design the two primers (6 nucleotides), and add an EcoR1 cut site to the forward primer (the 6-letter sequence), and BamH1 cut site to the reverse primer. Look up the cut site sequence. Label the restriction enzyme cut sites and add two overhang bases. Cut sites are included in the Tm. 5’-CTATGAGGTCCTGCGTTAGTGTTACC-3’ Forward: Tm: Reverse: Tm: Annealing temperature:
Instructions: Design primers for genotyping a 200bp deletion in gene Y6B3B.10 (WIT 7470 bp). Copy and Paste in the space below deletion in gene Lng-1gk327) Q1. (2 pts) Annotate (highlight) your primers. Provide your sequences below in the provided space as needed for ordering. orward Q2. (I pt) In a single sentence explain what the functional group must be on your primer and what is its purpose? the 3' end of Q3.(1 pt) List 4 key properties that your primers...
Instructions: Design primers for genotyping a 200bp deletion in gene Y6B3B.10 (WIT 7470 bp). Copy and Paste in the space below deletion in gene Lng-1gk327) Q1. (2 pts) Annotate (highlight) your primers. Provide your sequences below in the provided space as needed for ordering. orward Q2. (I pt) In a single sentence explain what the functional group must be on your primer and what is its purpose? the 3' end of Q3.(1 pt) List 4 key properties that your primers...
Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc 1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...
You realize the primers you're using were designed incorrectly, with the reverse primer reading in the forward (5' to 3') direction rather than reverse direction. How will this affect the PCR product?
Problem.1: What does a PCR optimization means? Problem.2: You are working on a gradient PCR to determine the optimum annealing temperature for your primer, and you get the following result. Problem.5: Your target is to amplify a promoter region of TRF2 gene. You design the following primer pair: Forward: 5'- CAGCGCTGCCTGAAACTC-3: Tm: 58.6°C, length: 18 bp, GC%: 61.11% Reverse: 5'- GTCCTGCCCCTTCACCTT-3' Tm: 59°C, length: 18 bp, GC%: 61.11% Product size: 200 bp -You get the following result: Marker CC CCC...