Question

If you were asked to design PCR primers to amplify this gene, provide in the space...

If you were asked to design PCR primers to amplify this gene, provide in the space below the sequences (5’ à 3’) of both the forward and reverse (sense and antisense) primers required to amplify the gene. Design your primers to be exactly 15 bases in length each. Design them so that the forward primer extreme 5’ end matches up with the extreme end of the start codon, and the reverse primer extreme 5’ end matches up with the extreme end of the stop codon.

Forward 5’ à 3’ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___

Reverse   5’ à 3’ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___

2572201 aaaaatagtt tacgatcgta aaaatctgca tatcatgata agagtggtta cattgccacg

2572261 ctgcttaacc cgccgatgcg cgggtttttt tgtacccaga atcctgtgag ctatacggaa

2572321 agtacacaga aaggaaggtg cgaccacaat taataacaaa atcttaaaaa ttgcacatgg

2572381 cactattagt tttctaaata ttgtgtattt tttgtattgc aggatgaccc tgtaacgaag

2572441 tttgcgtaac agcattttgc tctacgagtt tgccagcctc ccccagtggc tggctttttt

2572501 atgtccgtaa catcctgtgt atcaataaat gttgttgtct acgtacgtca agtagtcgca

2572561 tgagatctga ccagatatgt taaggttgca gctctctttg aatataatta tcattttcat

2572621 tacgttattg ttacgtttat ccggtgcgcc gtaaaacgcc gtccttcagg gggtggagga

2572681 tgtcaagaat atagttatcg tatggtgctc aaggagtatt gtgtaatatg aaaataatta

2572741 tttttagagt gctaactttt ttctttgtta tcttttcagt taatgtggtt gcgaaggaat

2572801 ttaccttaga cttctcgact gcaaagacgt atgtagattc gctgaatgtc attcgctctg

2572861 caataggtac tccattacag actatttcat caggaggtac gtctttactg atgattgata

2572921 gtggcacagg ggataatttg tttgcagttg atgtcagagg gatagatcca gaggaagggc

2572981 ggtttaataa tctacggctt attgttgaac gaaataattt atatgtgaca ggatttgtta

2573041 acaggacaaa taatgttttt tatcgctttg ctgatttttc acatgttacc tttccaggta

2573101 caacagcggt tacattgtct ggtgacagta gctataccac gttacagcgt gttgcaggga

2573161 tcagtcgtac ggggatgcag ataaatcgcc attcgttgac tacttcttat ctggatttaa

2573221 tgtcgcatag tggaacctca ctgacgcagt ctgtggcaag agcgatgtta cggtttgtta

2573281 ctgtgacagc tgaagcttta cgttttcggc aaatacagag gggatttcgt acaacactgg

2573341 atgatctcag tgggcgttct tatgtaatga ctgctgaaga tgttgatctt acattgaact

2573401 ggggaaggtt gagtagtgtc ctgcctgatt atcatggaca agactctgtt cgtgtaggaa

2573461 gaatttcttt tggaagcatt aatgcaattc tgggaagcgt ggcattaata ctgaattgtc

2573521 atcatcatgc atcgcgagtt gccagaatgg catctgatga gtttccttct atgtgtccgg

2573581 cagatggaag agtccgtggg attacgcaca ataaaatatt gtgggattca tccactctgg

2573641 gggcaattct gatgcgcaga actattagca gttgaggggg taaaatgaaa aaaacattat

2573701 taatagctgc atcgctttca tttttttcag caagtgcgct ggcgacgcct gattgtgtaa

2573761 ctggaaaggt ggagtataca aaatataatg atgacgatac ctttacagtt aaagtgggtg

2573821 ataaagaatt atttaccaac agatggaatc ttcagtctct tcttctcagt gcgcaaatta

2573881 cggggatgac tgtaaccatt aaaactaatg cctgtcataa tggaggggga ttcagcgaag

2573941 ttatttttcg ttgacttaga atagctcagt gaaaatagca ggcggagatt cataaatgtt

2574001

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Forward Primer: 5’ aatctgcatatcatg 3’

Reverse primer: 5’ ttatgaatctccgcc 3’

Since start codon is AUG, so while designing the forward primer we need to focus on first finding the very first ATG in the sequence. We can design primers including this region in primer.

Similarly while designing reverse primer for the sequence we need to find the lastest of either TAA, TGA, or TAG which are corresponding sequences of UAA, UGA or UAG respectively as stop codons.

These sequences have been highlighted in the picture below.

Add a comment
Know the answer?
Add Answer to:
If you were asked to design PCR primers to amplify this gene, provide in the space...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 1. Create the primers to amplify the gene of interest. 1. Below is almost the full...

    1. Create the primers to amplify the gene of interest. 1. Below is almost the full sequence of the coding strand of the F9 gene (exon 2-exon4) that you found in the online database (NCBI, Genomic sequence F9 gene). Some of the sequence is missing, but you know how many nucleotides are skipped. Design forward and reverse primers 18nt each for PCR that will isolate EXACTLY the sequence that is in bold typeface. Exon 2 = 164 nt Intron 2...

  • To do the PCR, we used 2 universal primers that roughly match sequences near the 5’...

    To do the PCR, we used 2 universal primers that roughly match sequences near the 5’ and 3’ ends of the 16S rRNA gene. The forward primer binds near the 5’ end to the complementary strand of the sequences shown below. The sequence of the forward primer is: Agagtttgatcctggctcag The reverse primer binds near the 3’ end to the sequences shown below. The sequence of the reverse primer is: ACGGCTACCTTGTTACGACTTG To find the primer in the sequence below, you must...

  • need help with this Tm: Tm: 16. You wish to amplify the DNA fragments below and...

    need help with this Tm: Tm: 16. You wish to amplify the DNA fragments below and add cut sites for subsequent cloning. Design both primers with the restriction enzymes cut sites listed, and add two overhang bases to each primer. Label the extra bases and cut sites. Each primer should be 14 nucleotides in length. a. 5'-CTATGAGGTCCTGCGTTAGTGTTACC-3' Forward: 5'- 5' EcoRI, 3' BamHI, overhang bases Reverse: 5'- Annealing Temperature: b. 5'- CCTGGGTGTTACATGCCATTAGCGTT-3' Forward: 5'- Tm: 5' HindiII, 3' Sphl, overhang...

  • Can you answer and explain it please Q. You want to PCR amplify the underlined/bold DNA...

    Can you answer and explain it please Q. You want to PCR amplify the underlined/bold DNA fragment. Design two primers for this job. The size of each primer is 18 bp -3 Forward primer: 5'- Reverse primer: 5'-( ATGACTATAGGGAACACTACGAGTGTGACAACGGTACGTAAC GCGGCGATCGAGCG ACCGAA GCTACTCCGCCTTTAGCTCTCGACAAT ATCGACGCCGCTA CGGATGTGTTTAGGCCTGGT GA TGCTGG AACCCTTTA TTCGCCGAGGAAG ATGTTATCAGCGGGTCTATCAGCATCA CGATCATCGTGAGCT GGTTCTTGGCTATTTCGGAGCAGGT GTCGAATCCGATGCT ITTGTGGGTGAGATGGGTTTATTCA GTGAAGTC ATCTTACGTACACGGA ACTCAGTGTGAATTGG AAGGC AGTTTAGCGAGTGATGCGCCGCGGATTTTGTATGCGATAGGTAT GCAGTTATCTAAGCGTTTATTGCTTACCAC

  • Design the two primers (6 nucleotides), and add an EcoR1 cut site to the forward primer...

    Design the two primers (6 nucleotides), and add an EcoR1 cut site to the forward primer (the 6-letter sequence), and BamH1 cut site to the reverse primer. Look up the cut site sequence. Label the restriction enzyme cut sites and add two overhang bases. Cut sites are included in the Tm. 5’-CTATGAGGTCCTGCGTTAGTGTTACC-3’ Forward: Tm: Reverse: Tm: Annealing temperature:

  • Instructions: Design primers for genotyping a 200bp deletion in gene Y6B3B.10 (WIT 7470 bp). Copy and...

    Instructions: Design primers for genotyping a 200bp deletion in gene Y6B3B.10 (WIT 7470 bp). Copy and Paste in the space below deletion in gene Lng-1gk327) Q1. (2 pts) Annotate (highlight) your primers. Provide your sequences below in the provided space as needed for ordering. orward Q2. (I pt) In a single sentence explain what the functional group must be on your primer and what is its purpose? the 3' end of Q3.(1 pt) List 4 key properties that your primers...

  • Instructions: Design primers for genotyping a 200bp deletion in gene Y6B3B.10 (WIT 7470 bp). Copy and...

    Instructions: Design primers for genotyping a 200bp deletion in gene Y6B3B.10 (WIT 7470 bp). Copy and Paste in the space below deletion in gene Lng-1gk327) Q1. (2 pts) Annotate (highlight) your primers. Provide your sequences below in the provided space as needed for ordering. orward Q2. (I pt) In a single sentence explain what the functional group must be on your primer and what is its purpose? the 3' end of Q3.(1 pt) List 4 key properties that your primers...

  • Please help with all questions. I provided all the information that I have. The sequence below...

    Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc   1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...

  • You realize the primers you're using were designed incorrectly, with the reverse primer reading in the...

    You realize the primers you're using were designed incorrectly, with the reverse primer reading in the forward (5' to 3') direction rather than reverse direction. How will this affect the PCR product?

  • Problem.1: What does a PCR optimization means? Problem.2: You are working on a gradient PCR to...

    Problem.1: What does a PCR optimization means? Problem.2: You are working on a gradient PCR to determine the optimum annealing temperature for your primer, and you get the following result. Problem.5: Your target is to amplify a promoter region of TRF2 gene. You design the following primer pair: Forward: 5'- CAGCGCTGCCTGAAACTC-3: Tm: 58.6°C, length: 18 bp, GC%: 61.11% Reverse: 5'- GTCCTGCCCCTTCACCTT-3' Tm: 59°C, length: 18 bp, GC%: 61.11% Product size: 200 bp -You get the following result: Marker CC CCC...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT