You have purified a sample of your protein of interest and have measured the A280 of a 1 in 3 dilution of the protein sample (1 cm pathlength). The value you have obtained for A280 was 0.576. Given th...
You have purified a sample of your protein of interest and have measured the A280 of a 1 in 3 dilution of the protein sample (1 cm pathlength). The value you have obtained for A280 was 0.576. Given that you do not know the sequence of your protein, calculate the approximate concentration of your original protein sample in mg/mL. Give your answer to 2 s.f.
Homework Answers
As a reference, a protein solution of concentration 1mg/ml produces an absorbance of 1 unit at 280nm.
Hence the conecntration of protein with absorbance (A280), of 0.576 = 1 X 0.576 = 0.576mg/ml
Since the sample is diluted in 1:3 ratio.
Therefore, the concentration of undiluted sample will be, 0.576 X 3 = 1.728mg/ml
Add Answer to:
You have purified a sample of your protein of interest and have measured the A280 of a 1 in 3 dilution of the protein sample (1 cm pathlength). The value you have obtained for A280 was 0.576. Given th...
You have isolated a sequence of double stranded DNA with the sequence below. The A260 (1 cm pathlength) of a 1 in 100 dilution of this sample is 0.64. Give the concentration of your sample in μM. Giv...
You have isolated a sequence of double stranded DNA with the sequence below. The A260 (1 cm pathlength) of a 1 in 100 dilution of this sample is 0.64. Give the concentration of your sample in μM. Give your answer to 3sf. GAGATACCAGATAGACACCAGATTGACACAGTAGACACAGATACATAGACAAACCCAGGATAGGGACATACCCAAAATT
1. You have been given a sample that is a 1/50 dilution of the original. You...
1. You have been given a sample that is a 1/50 dilution of the original. You measure 3.4 mg glucose in 0.5 ml of that sample. What is the concentration in the original sample? If you have 400 ml of that sample, how many grams of glucose is in the total sample?
Multi-part question according to lab textbook: A student is analyzing crude cellular extract for protein content....
Multi-part question according to lab textbook: A student is analyzing crude cellular extract for protein content. Crude cellular extract is simply the cellular contents obtained by lysing (breaking open) cells. Which method (A280 or biuret) would be the most appropriate method for determining protein concentration and why? A student has purified a blood protein with an extinction coefficient of 1.86 (mg cm/mL^-1) which the student compares to another blood protein which has an extinction coefficient of 0.72 (mg cm/mL^-1). Which...
You have obtained 150 µL of a protein sample of which you want to perform a...
You have obtained 150 µL of a protein sample of which you want to perform a Bradford Assay. You perform a 10-fold dilution of your sample and use 10 µl of this dilution to quantify the amount of protein using a Bradford assay. You obtain an absorbance value of 0.63. Using the standard curve and equation you obtained in class, determine the concentration of protein (µg/µL) of your original sample. Show your work. equation: y=0.0139x-0.0153
11. From the table in question 10, describe a general technique for separating histidine from a...
11. From the table in question 10, describe a general technique for separating histidine from a mixture of His, Tyr, and Arg using an anion exchange media. At what pH would you equilibrate the column? At what pH would each amino acid elute? charged group 12. Compare the dye-binding protein concentration assays, Bradford and BCA in terms of accuracy and ease-of-use. The dyes bind to different areas of the protein. How does this impact their accuracy? How can you improve...
Lab 5: Additional Dilution Problems You have a stock solution that contains 24 mg/ml of protein....
Lab 5: Additional Dilution Problems You have a stock solution that contains 24 mg/ml of protein. You want to make a set of standards with the following concentrations: 12 mg/ml, 6 mg/ml, 3 mg/ml and 1.5 mg/ml You need a minimum of 500 ul of each standard after all dilutions are completed. Using the technique of serial dilution, explain how you would make your standards by filling in the chart below. Std 4 Std 1 12 Std 2 6 Std...
1. You want to prepare a 1:50 dilution of your protein extract in a total volume...
1. You want to prepare a 1:50 dilution of your protein extract in a total volume of 1000 uL. You will need ___ uL of protein extract and ___ uL of water. 2. You are provided with a solution of BSA that is 100 ug/mL and make a 10-2 dilution? What is the resulting concentration of the DILUTED BSA? 3. Which of the following statements about enzymes is true? Select one: a. Enzymes increase the rate of a chemical reaction...
1. Make a 10 fold serial dilution of a protein to achieve a final concentration of...
1. Make a 10 fold serial dilution of a protein to achieve a final concentration of 10ug/ml You are staring from a 10 mg/ml protein stock. Indicate the amount of sample needed (from previous tube) and the amount of H20 needed. Make your calculations for 100μ1 volume. (0.5pts) 10ul 90μ1 H20 10mg/ml lmg/ml
A. You have been given a tube of E. coli. You are asked to make 1...
A. You have been given a tube of E. coli. You are asked to make 1 mL total volume of 10-1 dilution of the bacterial culture. Explain how you would do this. Show all necessary calculations. ____ ml cells + _____ ml water = 1 ml (total volume) B. Next, you were asked to make a 10-2 dilution of the bacterial sample. Explain how you would perform this. Show all necessary calculations. You have bacteria at a concentration of 2...
2.(1 point) You have 125 μLof a protein sample. Of this, you dilute30μLinto 120μLof buffer. 50μL...
2.(1 point) You have 125 μLof a protein sample. Of this, you dilute30μLinto 120μLof buffer. 50μL of that dilution were used for a Bradford assay and produced an absorbance of 0.53.Using the standard curveyou built in the lab using BSA, find the protein concentration (in μg/μL) of the original protein sample. Show your work. (Hint: first find the dilution fold of the sample that was used for the assay.) Note: equation from standard curve: y=0.0093x + 0.1877 show all work.
11. From the table in question 10, describe a general technique for separating histidine from a mixture of His, Tyr, and Arg using an anion exchange media. At what pH would you equilibrate the column? At what pH would each amino acid elute? charged group 12. Compare the dye-binding protein concentration assays, Bradford and BCA in terms of accuracy and ease-of-use. The dyes bind to different areas of the protein. How does this impact their accuracy? How can you improve...
Lab 5: Additional Dilution Problems You have a stock solution that contains 24 mg/ml of protein. You want to make a set of standards with the following concentrations: 12 mg/ml, 6 mg/ml, 3 mg/ml and 1.5 mg/ml You need a minimum of 500 ul of each standard after all dilutions are completed. Using the technique of serial dilution, explain how you would make your standards by filling in the chart below. Std 4 Std 1 12 Std 2 6 Std...
1. Make a 10 fold serial dilution of a protein to achieve a final concentration of 10ug/ml You are staring from a 10 mg/ml protein stock. Indicate the amount of sample needed (from previous tube) and the amount of H20 needed. Make your calculations for 100μ1 volume. (0.5pts) 10ul 90μ1 H20 10mg/ml lmg/ml
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago