Question

You have isolated a sequence of double stranded DNA with the sequence below. The A­260 (1 cm pathlength) of a 1 in 100 dilution of this sample is 0.64. Give the concentration of your sample in μM. Giv...

You have isolated a sequence of double stranded DNA with the sequence below. The A­260 (1 cm pathlength) of a 1 in 100 dilution of this sample is 0.64. Give the concentration of your sample in μM. Give your answer to 3sf.

GAGATACCAGATAGACACCAGATTGACACAGTAGACACAGATACATAGACAAACCCAGGATAGGGACATACCCAAAATT

0 0
Add a comment Improve this question Transcribed image text
Answer #1

GAGATACCAGATAGACACCAGATTGACACAGTAGACACAGATACATAGACAAACCCAGGATAGGGACATACCCAAAATT

= Amino acid sequence E I P D R H Q I D T V D T D T T N P G R D I P K I

It doesn't contain W,Y and C amino acid.

DNA conc. is calculated by this aquation; OD of diluted dsDNA at 260nm * Dilution factor * 50= 0.64 × 100× 50 = 3200 ng/ul

Add a comment
Know the answer?
Add Answer to:
You have isolated a sequence of double stranded DNA with the sequence below. The A­260 (1 cm pathlength) of a 1 in 100 dilution of this sample is 0.64. Give the concentration of your sample in μM. Giv...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • You have purified a sample of your protein of interest and have measured the A280 of a 1 in 3 dilution of the protein sample (1 cm pathlength). The value you have obtained for A280 was 0.576. Given th...

    You have purified a sample of your protein of interest and have measured the A280 of a 1 in 3 dilution of the protein sample (1 cm pathlength). The value you have obtained for A280 was 0.576. Given that you do not know the sequence of your protein, calculate the approximate concentration of your original protein sample in mg/mL. Give your answer to 2 s.f.

  • 3. Shown below is a double stranded DNA. Replicate this DNA fragment and show the products...

    3. Shown below is a double stranded DNA. Replicate this DNA fragment and show the products formed from this replication. Remember, in replication, each strand is copied into a new daughter strand. In your answer, indicate which strands are the new daughter strands (mark with D) and which strands are the already existing parent strands (mark with P as shown below). Label the 5’ and 3’ ends of all DNA. HINT: You should have 2 double-stranded DNA fragments after replication....

  • Consider the double-stranded DNA sequence of a gene below: Strand 1 5'- AATCGTATGCGAAGCCCTTAACT-3' Strand 2. С...

    Consider the double-stranded DNA sequence of a gene below: Strand 1 5'- AATCGTATGCGAAGCCCTTAACT-3' Strand 2. С стената. 3. TTAGCATACGCTTCGGGAATTGA-5' The number of amino acids in the corresponding peptide is: OA.O B.1 OC3 0.4 O E.5 Consider the following double-stranded region of a gene: Strand 17 5'- AATCGTATGCGAAGCCCTTAACT-3 Strand 2A 3'-TTAG CATACGCTTCGGGAATTGA-5 The number of mRNA codons in the corresponding transcriptis O A1 OB.4 OC.5 OD.6 E. Cannot be determined

  • In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1)....

    In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL LETTERS (e.g., GGCGGT), and work your way from the top to the bottom. A) Fill in the complementary DNA bases for DNA Strand 2 to form a complete double-stranded DNA molecule. B) Create an mRNA strand that is complementary to DNA Strand 1. C) Using the mRNA sequence that you just created, determine the complementary...

  • A segment of a double-stranded DNA molecule is shown below. The start of a gene is...

    A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...

  • 1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA...

    1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...

  • a) What is the total net charge of double-stranded DNA that is 500 basepairs (bp) in...

    a) What is the total net charge of double-stranded DNA that is 500 basepairs (bp) in length? b) In agarose gel electrophoresis, two parallel and oppositely charged electrodes are situated at opposite ends of the gel. The surrounding solution is a “buffer”, an aqueous salt solution maintained at constant pH. The gel is made in the same buffer, with a small concentration of agarose. Because the concentration of agarose is small , everything between the electrodes can be considered to...

  • 1. You have been asked to make a 1:5 dilution of 20mL of patient sample. The...

    1. You have been asked to make a 1:5 dilution of 20mL of patient sample. The final volume should be 100mL. Which of the following outlines the correct way to make this dilution? For the other answer options, explain why they are incorrect. A. 10mL of patient sample added to 40mL of saline B. 10mL of patient sample added to 50mL of saline C. 20mL of patient sample added to 100mL of saline D. 20mL of patient sample added to...

  • What is the concentration of cells in the starting sample if 1 ml was plated per...

    What is the concentration of cells in the starting sample if 1 ml was plated per dilution and the starting sample was river water? Report your answer below as a decimal with one significant digit after the decimal and report the exponent the separate box. See this example, if your answer is 5.2 x 108 you would report it as "5.2" You have the following results from a serial dilution experiment: Sample Dilution Plate Count 1:101 Too many to count...

  • You have isolated an unknown colored compound (MW = 200,000 g/mol) with a concentration of 5...

    You have isolated an unknown colored compound (MW = 200,000 g/mol) with a concentration of 5 mg/mL. After you add 2 mL of your unknown to 8 mL of buffer, you obtain an absorption spectrum of your colored compound. You record an Absorbance value of 0.57 at its lambda max, 460 nm. The light path is 1 cm. Calculate the molar concentration (M) of your diluted sample. Show your work.        B. Calculate the extinction coefficient (M-1cm-1) of your diluted...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT