Question

ll erence between Mg and Mg2) uutur 4. Would you call DNA and/or protein smart material? Why or why not?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Yes DNA and proteins are smart materials due to following reasons.

1. Our cells need to divide so we can grow and re-build, but every cell needs to have the instructions. DNA gives those instructions efficiently so that a new copy of itself must be made before a cell divides.

2.DNA may be small but with properties including flexibility, replication, stability and the ability to store large amounts of data, there's a reason why it must be one of the smartest molecules.

3. DNA is very stable under several conditions, it can last for a very, very long time. This is why scientists have been able to extract and analyse DNA taken from species that have been extinct for thousands of years.

4. On the other hand, Proteins play a role in nearly every biological process, and their functions vary widely and efficiently.

5. Proteins can catalyse many biological processes and they are highly efficient.

6. Many proteins are involved in signalling process in the cell. So indeed they are very efficient and smart materials.

Add a comment
Know the answer?
Add Answer to:
ll erence between Mg and Mg2) uutur 4. Would you call DNA and/or protein smart material? Why or why not? ll erence between Mg and Mg2) uutur 4. Would you call DNA and/or protein smart materia...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Study the interaction between proteins and DNA in more than 100 protein-DNA complexes. Arginine: A-7 T-5...

    Study the interaction between proteins and DNA in more than 100 protein-DNA complexes. Arginine: A-7 T-5 G-26 C-1 Glutamate: A-? T-? G-1 C-11 Tryptophan A-? T-? G-? C-? Explain why you could not find any single bonds between tryptophan and one of the DNA bases. Explain why you found single hydrogen bonds between glutamate and some of the DNA bases. Is there a preference of arginine for one of the amino acids?

  • Microbiology: You have the following working hypothesis: To bind well to a DNA-binding protein, a DNA...

    Microbiology: You have the following working hypothesis: To bind well to a DNA-binding protein, a DNA target site must twist less tightly and widen the narrow groove between base pairs 4 and 5. Suggest an experiment to test your hypothesis.

  • POST-LAB QUESTIONS 1. Based on the results of the three tests, how do you kno the fruit was DNA and not protein? Explai...

    POST-LAB QUESTIONS 1. Based on the results of the three tests, how do you kno the fruit was DNA and not protein? Explain. 2. What happened to the egg white sample, containing mostly protein, when you heated it or oered the pH? Explain what you saw and what you think was happening at the molecular level. 3. Why does the DNA double helix unravel when exposed to high temperatures or acidic conditions? If you tried to run this experiment with...

  • HP1 is a DNA binding protein that interacts with a specific sequence (TGCTTATTC). You want to...

    HP1 is a DNA binding protein that interacts with a specific sequence (TGCTTATTC). You want to analyze, by a Dnase I footprinting assay, the effect on DNA binding of the interaction between HP1 and its 6 binding partner PA. In each assay, you combine a radiolabeled fragment of DNA that binds to HP1 and a specific combination of proteins. After incubation with DNase I, each reaction mixture was resolved by gel electrophoresis, and then exposed to film. The autoradiogram showing...

  • What would be difference between the IRs of p-toluic acid (starting material) and 4- (bromomethyl)benzoic acid...

    What would be difference between the IRs of p-toluic acid (starting material) and 4- (bromomethyl)benzoic acid (product)? (You don’t need to look up the IR of p-toluic acid, just think about what is changing between the starting material and product). Why is IR not a good way to verify that you made product?

  • What is the relationship between protein translation and gene expression? Would you expect to always see...

    What is the relationship between protein translation and gene expression? Would you expect to always see correlation between these two? Discuss a circumstance within the context of cancer where mRNA and protein expression may not correlate. Why is it important to look at both protein and RNA levels of a series of genes/proteins in a molecular pathway? Discuss this in the context of cancer associated pathways. Give a specific example of a pathway that is independent of gene expression in...

  • Explain the experimental reason you used the following samples to transfect cells: 1. no DNA (Genejammer...

    Explain the experimental reason you used the following samples to transfect cells: 1. no DNA (Genejammer without plasmid) 2. 1 mg pSV b-gal 1 mg VHSV NVMH 3. 1 mg pSV b -gal + 0.5mg VHSV PMH (this plasmid expresses a yellow fluorescent protein tagged splicing factor) 4. 1 mg pSV b -gal + 2.5 mg VHSV PMH Is this a properly set up experiment? Explain why or why not?

  • You are given the following sequence of DNA which encodes for a short protein (this is...

    You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...

  • Protein Metabolism. Please answer the following questions about protein metabolism. Thank you! Why would a cell...

    Protein Metabolism. Please answer the following questions about protein metabolism. Thank you! Why would a cell produce an exoenzyme, protease, to break down proteins? Why would that be an “exoenzyme?” What do proteins have to lose to become pyruvic acid? What is that reaction called?

  • O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...

    O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT