Question

If a mRNA had the nucleotide sequence 51-AUGCCCUUUCAUUACCCGGUA-3 Enter the sequence of the DNA from 3 to 5. Click in the an
0 0
Add a comment Improve this question Transcribed image text
Answer #1

mRNA (5'-3') is transcribed using DNA strand (3'-5') as template.

So, the sequence is complementary as per Chargaff rules.

A opposite U, T opposite A, C opposite G and G opposite C

So, answer is

3' - TACGGGAAAGTAATGGGCCAT -5'

Add a comment
Know the answer?
Add Answer to:
If a mRNA had the nucleotide sequence 51-AUGCCCUUUCAUUACCCGGUA-3' Enter the sequence of the DNA from 3 to 5'. Cli...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT