Question

(References) Consider the short fragment of DNA below. Using their one-letter abbreviations, and typing with capital letters
[References) Consider the short fragment of DNA shown below. Using their one-letter abbreviations, and typing wiht capital le
(References) Consider the short DNA fragment shown below. Using their one-letter abbreviations, and typing using capital lett
0 0
Add a comment Improve this question Transcribed image text
Answer #1

As we know that, in case of DNA there are four types of the nucleobases which are Adenine (A), Thymine (T), Guanine (G) and CSo, the complementary sequence for the above sequence is given as below:- 5 – CGGTAAGCATGCAATCTTATGGATAGGCGCTAAT – 3 Part (

So, the complementary sequence for the above sequence is given as below:- 5- CCCGATAATAATGTGGCCCATAATGGATTGAATTCGCGCTC GC –5 - GCCAATGCTTAGTATTTACAAATCCTCGTCATTAGCTGGG - 3 So, the complementary sequence for the above sequence is given as below:-

Add a comment
Know the answer?
Add Answer to:
(References) Consider the short fragment of DNA below. Using their one-letter abbreviations, and typing with capi...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • References Consider the short DNA fragment shown below. Using their one-letter abbreviations, and typing using capi...

    References Consider the short DNA fragment shown below. Using their one-letter abbreviations, and typing using capital letters with no spaces, give the corresponding sequence of amino acids. 5-GCCAATGCTTAGTATTTACAAATCCTCGTCATTAGCTGGG -3 Answer: Submit Answer Try Another Version 2 Item attempts remaining

  • Give the amino acid sequence in the following tetrapeptide using both 3-letter and 1-letter abbreviations for the amino acids. (Capitalize amino acid abbreviations appropriately.) ball & stick la...

    Give the amino acid sequence in the following tetrapeptide using both 3-letter and 1-letter abbreviations for the amino acids. (Capitalize amino acid abbreviations appropriately.) ball & stick labels Sequence 3-letter abbreviations) (Separate abbreviations with hyphens.) Sequence (1-letter abbreviations) Do not separate abreviations with hyphens.) Give the amino acid sequence in the following tetrapeptide using both 3-letter and 1-letter abbreviations for the amino acids. (Capitalize amino acid abbreviations appropriately.) ball & stick labels Sequence 3-letter abbreviations) (Separate abbreviations with hyphens.) Sequence...

  • Use the codon table below to transcribe and translate this message using the one-letter abbreviations for...

    Use the codon table below to transcribe and translate this message using the one-letter abbreviations for amino acids.

  • 3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND...

    3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...

  • 1. Amino acids have both a three letter, and a one letter code, for example the...

    1. Amino acids have both a three letter, and a one letter code, for example the amino acid Glycine is “Gly” or “G.” There are 20 single letter codes for amino acids, which is almost an entire alphabet. (skip any letters without a corresponding amino acid) it would make. A. For example:  “Ryan Smith”, would be: “Arginine, Tyrosine, Alanine, Asparagine, Serine, Methionine, Isoleucine, Threonine, Histidine” B. Take this sequence of amino acids, and write out a sequence of RNA that could...

  • Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a...

    Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a beginning of a polypeptide. GTGATGCGGCGCGCGCCACCACATGTGAAAAAATAACTCCGGCATTACGAACCTCGAAGAATCGGGATTTAGCCATTATAGCTAGCC 1. Write down the sequence of mRNA which will be transcribed from this DNA. Hint: it is impossible to identify the first base of a mRNA accurately from just sequence analysis, therefore, chose the first base within plus-minus 2 bp from a real start. (10 points) ABC 2. Write the N-terminal portion of polypeptide which is encoded by this...

  • Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into...

    Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into its corresponding protein (USING SINGLE LETTER ABBREVIATIONS of the amino acids), and 3) determine the protein sequence if you had a DELETION mutation of the emboldened thymine. 3’                                                                                                                                                                           5’ TCGGCGTGTACTACTACACGGTATATACGTTTCTTTTGATTAGCCGCTT

  • The following is a partial DNA coding segment from Homo sapiens CD4 gene that encodes a...

    The following is a partial DNA coding segment from Homo sapiens CD4 gene that encodes a membrane glycoprotein of T lymphocytes. 5’ACCGGGGAGTCCCTTTTAGGCACTTGCTTCTGG3’ 1. Produce the corresponding RNA fragment. 2. Produce the partial primary protein sequence (one letter codes for amino acids) using reading frame 3.

  • The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...

    The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...

  • The DNA sequence of a fragment in the middle of a gene is listed below. Show...

    The DNA sequence of a fragment in the middle of a gene is listed below. Show all the possible amino acid sequences that can be coded from this fragment. Hint: Both strands can be used as the template. 5'-ATCGTTCTTAC-3' 3'-TAGCAAGAATG-5'

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT