Question

(References) Consider the short fragment of DNA below. Using their one-letter abbreviations, and typing with capital letters and no spaces, give the corresponding sequence of amino acids. 3' - GCCATTCGTACOTTAGA ATACCTATCCGCGATTA.5 Answer:

Answer 1

As we know that, in case of DNA there are four types of the nucleobases which are Adenine (A), Thymine (T), Guanine (G) and Cytosine (C). These nucleobases bind with their complementary through the hydrogen bond in the DNA. Guanine (G) binds with Cytosine (C) denoted as G-C and Adenine (A) binds with Thymine (T) denoted as A-T through the hydrogen bonds in the DNA. Part (1):- The given sequence is as follows:- 3' - GCCATTCGTACGTTAGAATACCTATCCGCGATTA - 5'

So, the complementary sequence for the above sequence is given as below:- 5' – CGGTAAGCATGCAATCTTATGGATAGGCGCTAAT – 3' Part (2):- The given sequence is as follows:- 3- GGGCTATTATTACACCGGGTATTACCTAACTTAAGCGCGAG CG - 5

So, the complementary sequence for the above sequence is given as below:- 5'- CCCGATAATAATGTGGCCCATAATGGATTGAATTCGCGCTC GC – 3 Part (3):- The given sequence is as follows:-

5' - GCCAATGCTTAGTATTTACAAATCCTCGTCATTAGCTGGG - 3' So, the complementary sequence for the above sequence is given as below:- 3' - CGGTTACGAATCATAAATGTTTAGGAGCAGTAATCGACCC - 5'