Question

Looking at the gene indicated in the figure below, identify the number of possible different starts looking at the coding potential mapIncorrect Question 5 0/2 pts Question5 Looking at the gene indicated in the figure below, identify the number of possible different starts looking at the coding potential map In this question, we throw a bit of a wrinkle at you. Up until this point, we have always read the gene from left to right (the start codon has been on the left and the stop codon has been on the right) much like we read text in a book from left to right. These are called FORWARD genes. To increase the amount of information that we pack in a genome, sometimes genes are read from right to left. These are called REVERSE genes. This gene is a REVERSE gene. How do you know? If you look at the thin black line in the center of the screen - this line represents the longest gene call see if you can find the stop codon (down tick) at the end of the line on the left side. There is also a start codon (uptick mark) right near the stop (down tick mark). You will see the potential start codons (upticks to the right of the stop codon) 37600 3 6 7

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer 5) The thin black line represents the open reading frame and the upward ticks are the potential start sites. So based on the figure give we can se that the frame in total has 7 upward ticks which means 7 potential start sites.

Add a comment
Know the answer?
Add Answer to:
Looking at the gene indicated in the figure below, identify the number of possible different starts...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using...

    INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3-A TTGCT TACTTGCA T-5° DNA 5 2) Does it matter which strand is the 'code strand'? The following two sequences look identical, except one runs 3-5' and the other 5'-3'....

  • A segment of a double-stranded DNA molecule is shown below. The start of a gene is...

    A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...

  • ASSIGNMENT For the DNA sequence given below, write the complementary DNA sequence that would complete the...

    ASSIGNMENT For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand.   DNA    3’—A   T   T  G   C   T   T   A  C   T   T  G   C   A   T -- 5’ DNA    5’-- Does it matter which strand is the ‘code strand’? The following two sequences look identical, except one runs 3’-5’ and the other 5’-3’. For each DNA sequence given below, write the mRNA sequence that would be coded from it. Make sure you indicate the direction of each mRNA strand (i.e. 3’ and 5’ ends).  Use the Universal triplet code to...

  • Read the DNAsequence given below in the 3’ to 5’ direction and circle all of thepotentialstart...

    Read the DNAsequence given below in the 3’ to 5’ direction and circle all of thepotentialstart codons (i.e. every time you see the DNA version of a start codon- as in answer to question 3). How many potentialstart codons did you find?_______________ Line YOUR DNA SEQUENCE (read from left to right) 1 3’- T T C C G T A A C T T C G G C G C A T C T A G C T T G...

  • Roadmap To start, use the provided template file (on Blackboard): project_01_template.py. Replace the pass statements with...

    Roadmap To start, use the provided template file (on Blackboard): project_01_template.py. Replace the pass statements with your code. Notice that we included test cases under every function. If you run the project_01_template.py file at this point it should print False for each test. After you write the correct code for each function, and then run the file, it should print True for each test. 1. Write a function named gc_content that takes one argument sed and performs the following tasks:...

  • 1 Overview and Background Many of the assignments in this course will introduce you to topics in ...

    1 Overview and Background Many of the assignments in this course will introduce you to topics in computational biology. You do not need to know anything about biology to do these assignments other than what is contained in the description itself. The objective of each assignment is for you to acquire certain particular skills or knowledge, and the choice of topic is independent of that objective. Sometimes the topics will be related to computational problems in biology, chemistry, or physics,...

  • 2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving...

    2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...

  • Please answer the following question below based on the information and figure. I just need a...

    Please answer the following question below based on the information and figure. I just need a description of which bulb will go brighter in each of the pictures. And any equations that would be necessary to explain this. It does not need to be worked out with numbers. Just the equations and words explaining how you can tell which glows brighter. Thanks! Below is also an example of how to set it up! UQAWA - Electricity Spring 2019 Pictured is...

  • I am currently trying to figure out the experiment below. Please complete Table 1 with an...

    I am currently trying to figure out the experiment below. Please complete Table 1 with an explanation, I appreciate it thank you!  Promise to give thumbs up! Introduction The phase differences between the output voltage, the voltage across the inductor, the voltage across the capacitor, and the voltage across the resistor will be examined at resonant frequency. The voltage and phase relationship will also be examined for frequencies above and below resonance. Theory An inductor, a capacitor, and a resistor are...

  • 1 L, as a dynamical system (Notes from Assignment #2) We take our definition of dynamical system ...

    1 L, as a dynamical system (Notes from Assignment #2) We take our definition of dynamical system to be an "object" along with a specific set of modifications that can be performed (dynamically) upon this object. In this case, the object is a bi-infinite straight road with a lamp post at every street corner and a marked lamp (the position of the lamplighter). There are two possible types of modifications: the lamplighter can walk any distance in either direction from...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT