Explain what sequence properties and functions you expect to find in a Eukaryotic gene's…
a. 5' noncoding region
b. 3' noncoding region
c. coding region
a) it is a subgroup with 9 full sequences are present. Two pyrimidine rich regions, double long stretch of sequences, and 22 hairpins , with divergence of sequence. The region is believed to have role in translation of the virus polyprotein.
b) it has a type specific region, a core element, a poly (U) stretch, a C(U)n repeat. This region has a major role in DNA replication.
c) its main role is translation and coding or the making up of mRNA,
hope the answer helps..
Explain what sequence properties and functions you expect to find in a Eukaryotic gene's… a. 5'...
The following base sequence is found for a mRNA fragment from wild-type E. coli: 5'- UAUCAGUAGAUAAUGUAACC-3' Assuming that this sequence corresponds to the middle of a gene's coding region, give the amino acid sequence of the protein you would expect the fragment to encode.
region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA sequence that encodes RNA and a o coding, barcoding o control, coding o noncoding, control o coding, control During transcription, the DNA template is read in the ___direction. o 3 to 5 oC to N terminal ON to C terminal 0 5' to 3' For genes encoding protein, which of the following is the eukaryotic consensus sequence of the promoter? ATAT o GCGC CGCG...
The following is a eukaryotic DNA sequence. The coding sequence of the gene is in bold and italicized, and the promoter is enclosed in parenthesis. 5′ T G*A A G G A A T (TA T A A) T A C G A C C... A T G A T G T A C G C A T AAAC G T 3′ A mutation occurs in which a base (T) is inserted into the DNA sequence after the G, at...
000_ U SEJJIBU contentId-_876188.1&step Question Completion Status: QUESTION 1 In eukaryotic genes, a. coding exons are separated by noncoding introns b. coding introns are separated by noncoding exons c. all genes consist of an uninterrupted coding sequence d.genes can include the coding sequences for multiple proteins e. both (c) and (d) QUESTION 2 A gene with 8 exons would have ___ introns. b.9 0.8 d. 24 e. 16 QUESTION 3 The gene for rhodopsin has 5 exons and 6706 nucleotides....
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The in tron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly -A tails are added following the sequence AGUUGG. The poly- A tails are 20 nucleotides. a. Predict the sequence of mature mRNA and denote 5’ and 3’ ends. b. If this is an oncogene that is elevated...
a piece of eukaryotic DNA is shown below: 5’- CACTCACCCGATTTTTGAATGCCGCTGATGAATCTCTGGTAA -3’ A) WHAT IS THE mRNA PRODCUED, IF THIS IS THE CODING STRAND? b)Assuming that after processing, a cap is added to the mRNA at the 5’ end, predict the amino-acid sequence of the protein produced from this piece of mRNA using SINGLE LETTER codes. In your answer denote both the amino and carboxy ends of the protein? THANKS FOR THE HELP.
1. OK. So, let's talk about Candyp, a delicious eukaryotic protein that tastes like a Snickers bar. a) You painstakingly derived the (mature) transcribed sequence for Candy, which is listed below. What would be the mRNA sequence that corresponds with this segment? coding 5 TA A TG C AGT AAGC 3' template 3 ATT A C GT CAT I C G 5' b) OK, how you need to get E. coli to make a whole bunch of that protein. What...
5. With regard to eukaryotic chromatin, what is a DNase hypersensitive site? What types of DNA sequences tend to be located at these sites? How would you demonstrate experimentally that a specific sequence is located with a hypersensitive site/region? Describe and provide hypothetical results. What is an LCR?
A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The intron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly-A tails are added following the sequence AGUUGG. The poly-A tails are 20 nucleotides. b. If this is an oncogene that is elevated in cancer cells, design two siRNAs to knock down the mRNA, list the sequences of the siRNAs...