You perform an experiment in which you add a synthetic mRNA to a test tube that contains all components required for translation (it was just lacking the mRNA). You find that a polypeptide consisting of 122 amino acids is produced. Then you perform another experiment, this time adding the mRNA from a mutant version of the gene and find that a polypeptide consisting of 48 amino acids was produced. What is a likely explanation for this observation?
| A. |
The mutant version of the gene must have a frameshift mutation upstream of the promoter, therefore a truncated protein is produced. |
|
| B. |
The mutant version of the protein has a frameshift mutation close to the 3' end of the protein coding region, so that a truncated version of the protein is produced. |
|
| C. |
The mutant version of the gene has a nonsense mutation, so that a truncated protein is produced. |
|
| D. |
The mutant version of the gene has a synonymous mutation so that a truncated version of the protein is produced. |
Answer:
Frameshift mutations lead to a change in the frame of how codons are read by translation machinery. This generally leads to a change in amino acid sequence of the protein.
Non-sense mutations are those which lead to generation of a "stop-codon". Stop codons are those which lead to termination of translation and the size of protein gets reduced.
Synonymous mutations do not lead to any change in the message encoded by a codon.
It is given that from 122 amino acids, protein size was reduced to 48 amino acids in the mutant. This can be most likely due to a non-sense mutation.
Hence, correct choice should be:
| c | The mutant version of the gene has a nonsense mutation, so that a truncated protein is produced. |
You perform an experiment in which you add a synthetic mRNA to a test tube that...
2. The following is a short mRNA. (Note: I have given you the mRNA already so just translate what I have given you. 5' CUCUACCUGGGGUGUAGAUGCACCUUGAUGGAGGGAUUCGUpuAGAUAGAGUGGG3 a. What is the amino acid sequence of the protein encoded for by this gene? b. If the gene above in "a" picks up the following mutation (indicated by bold and arrow), it is known (sense, nonsense, missense, frameshift, silent, etc.) mutation. as a 5 CUCUACCUGGGGUGUAGAUGCACCUTGAAGGAGGGAUUCGUUUUAGAUAGAGUGGG3 c. If the gene above in "a" picks up...
Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript containing 1200 bases, which is translated into a protein containing 300 amino acids. A. How long is the coding sequence in this mRNA and how many nucleotides are in the UTRs? For the purposes of this question we are ignoring the G’ cap and the polyA tail. B. A mutant form of the gene created by one nucleotide being changed to another nucleotide also...
Please answer all.... Thank you!
81)If a polypeptide chain contains 600 amino acids, then the
gene coding for this polypeptide must contain _____.
600 nucleotides
1200 nucleotides
1800 nucleotides
1800 codons
1800 anticodons
More than one of the above are correct.
82) When we altered gene triplet in the DNA produces a chain-terminating codon in the mRNA, the (1pts) result is called a reverse mutation nonsense mutation missense mutation spontaneous mutation frameshift mutation 83) A single base substitution changes the...
You are studying a human mRNA that you believe is controlled at the level of translation. You think that the 5’-UTR plays a role by binding to a protein that prevents the initiation of translation. To definitively determine the role of the 5’-UTR, you decide to clone the 5’UTR of the gene upstream of GFP open reading frame in a mammalian expression vector. Question: Describe an experiment that you would perform using this vector to prove that the 5’ UTR...
Please help me with biology
1. Online exercise: Find reports that document the relationship between the age of the mother and the risk for having a baby with Down Syndrome (Trisomy 21). For your interest only 2. Suppose that during transcription of a gene, RNA polymerase mistakenly inserts an incorrect base opposite the template DNA. This error results in an mRNA with an altered nucleotide sequence. Is this a mutation? For questions 3-10, consider the following mRNA, which is the...
Can anyone explain these answers step by step. Especially I do
not know how to start question 1 or two!!! Thank you!
Work with a partner to complete the following questions. 1. Fill in the bases of the complementary DNA strand. 3-TATAATTACGCTAGATCACCCACT5 2. Transcribe the mRNA sequence using the bottom (3 to 5) strand as the template. What is the name of the sequence upstream of the gene that the RNA polymerase binds to? 3. 4. What polypeptide sequence would...
You wish to determine if there is a mutation somewhere within the promoter of the adult b-globin gene that could possibly be responsible for a case of b-thalassemia. Which ONE method, when compared to the same process performed on wild type DNA, would NOT provide you with information that could be consistent with this idea? A) Prepare a pair of 18 nucleotide long primers that hybridize upstream and downstream of the promoter, perform PCR, and sequence the resulting fragment B)...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
13. A researcher studying hemoglobin predicts tha aying hemoglobin predicts that a histidine within the protein is Portant for binding oxygen. She used site-directed mutagenesis to change histidine (CAU) to one for lysine (AAA). However, the mutant hemos as well as the wild-type and has no other apparent changes. This type utagenesis to change a codon for the mutant hemoglobin still binds oxygen anges. This type of mutation is called A. suppression B. synonymous C. nonsense D. silent E. frameshift...
22. What are the roles of Dicer and RISC in the function of miRNAs? Dicer RISC 23. Describe the concepts of primary, secondary, tertiary and quaternary protein structure 24. Here is a short sequence of codons. AUG CAU UGU UUU Write out the amino acids this sequence of codons encodes. Now add an insertion mutation of your choosing in the first codon and write out the new mutant sequence. What are the first four amino acids encoded by this mutant...