Transcription is the process in which a DNA sequence is copied into an RNA molecule. The DNA sequence is read by the enzyme RNA polymerase that synthesizes an RNA molecule that is complementary to the DNA sequence. However, unlike DNA replication, only one DNA strand acts as a template during transcription. The DNA strand is read in the 3` to 5` end and RNA is synthesized in the 5`->3` direction , thus acting as a template strand, whereas the 5` to 3` strand of DNA is known as coding strand as its sequence is same as that of the RNA transcript.
5` GCGATGCCA 3` Coding strand
3` CGCTACGGT 5` Template strand
Thus, the 3` to 5` strand will act as a template for RNA transcript and the resulting mRNA transcript will be complementary to this strand. Thus the RNA sequence would be
5` GCGAUGCCA 3`
Thus option 3 is the correct answer.
The following diagram represents DNA that is located in the middle part of the RNA-coding sequence...
region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA sequence that encodes RNA and a o coding, barcoding o control, coding o noncoding, control o coding, control During transcription, the DNA template is read in the ___direction. o 3 to 5 oC to N terminal ON to C terminal 0 5' to 3' For genes encoding protein, which of the following is the eukaryotic consensus sequence of the promoter? ATAT o GCGC CGCG...
The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3'CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5 GUACCUGUCcauucuuauguugugucCAGCCGUACUGC What would be the immatur RNA sequence transcribed...
Answer please?
The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3 CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5' What would be the immature RNA...
1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3', uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?
Part A What are three observations that suggested eukaryotic RNA was an intermediate between DNA and protein? Select the three observations. O DNA plays the major role in replication, which allows for sustainable transfer of genetic information. O RNA is transported out of the nucleus and into the cytoplasm where protein translation occurs. Three types of RNA are found in the cell, and all of them are involved in protein synthesis. O DNA is found in the nucleus and protein...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
1) Using the bacterial DNA sequence that the instructor gave you:a. Identify and underline the promoter region and the start codon.b. Identify the coding and template strandc. Transcribe the coding sequenced. Translate the mRNA sequence8) Which of the following mutational changes would you predict to be the most deleterious to gene function? Explain your answers.a. Insertion of a single nucleotide near the end of the coding sequence.b. Removal of a single nucleotide near the beginning of the coding sequence.c. Deletion...
The following is a eukaryotic DNA sequence. The coding sequence of the gene is in bold and italicized, and the promoter is enclosed in parenthesis. 5′ T G*A A G G A A T (TA T A A) T A C G A C C... A T G A T G T A C G C A T AAAC G T 3′ A mutation occurs in which a base (T) is inserted into the DNA sequence after the G, at...
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) Assume GTACCGATCAGCAGTCA and CATGGCTAGTCGTCAGT are introns 1) Which strand will be the template strand for the transcription? 2) Write down the mature messenger RNA sequence, label the 5' and 3' ends, and additional elements found in mature messenger RNA. 3) Based on the mRNA sequence, draw a line between each codon in question 2) and write the sequence for the polypeptide that can be...
Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005