Determine theoretical fragments produced by restriction digest
of Lambda DNA. Use Lambda DNA restriction sites document to
identify the location of the cut sites for a given enzyme. The
Lambda DNA represented below by the horizontal line runs from 1 to
48,502 nucleotide base pairs.
Homework Answers
Add Answer to:
Determine theoretical fragments produced by restriction digest
of Lambda DNA. Use Lambda DNA restriction sites document...
on the me but not with the larger fragments on o t and more and record...
on the me but not with the larger fragments on o t and more and record med in the h 3. Determine the distracted for each bund data bere 4. Determine the distance traveled for each and generated in the double digest and record data bere tion Endonuclease Digestion and Gel Electrophoresis of DNA 185 VI. RESTRICTION MAPPING The different DNA fragments generated by different map DNA. For example, specific DNA on 2000 nucleotides in las Rl or Hind and...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...
1) If a restriction enzyme cuts a circular DNA into five fragments, how many restriction sites...
1) If a restriction enzyme cuts a circular DNA into five fragments, how many restriction sites are there in the DNA? 2) How many molecules of DNA will be present after 6 cycles of PCR, if you started with one double-stranded DNA molecule? CELL BIOLOGY QUESTIONS!! SHOW WORK PLEASE
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers...
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...
1. How many fragments were produced? 2. What is the size of the fragments? Custom Digest...
1. How many fragments were
produced?
2. What is the size of the fragments?
Custom Digest NEW ENGLAND Print Close BioLabs NEBcutter unnamed sequence - digested with: Alul mment Gel Type: DNA Type: Unmethylated Marker: 1% agarose Lambda - Hindll Digest L=102 mm OK Length (bp) Ends Coordinates narker 1| (LeftEnd)-Alul 1-167 2Alul-(RightEnd) 217-308 3 Alul-Alul 167 92 49 10000 168-216 5000 1000 500 100
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this...
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...
Unanswered Question 6 0/1 pts A restriction digest is performed on a plasmid. The table below...
Unanswered Question 6 0/1 pts A restriction digest is performed on a plasmid. The table below shows the sizes of the resulting DNA fragments. 3 enzyme(s) present in the DNA size fragments digest resulting Pstl 10,000 base pairs (bp) Sspl 7,000 bp, 3,000 bp double digest, Estland 4,000 bp, 3,000 bp Sspl Explain the double digest results, what happened to create pieces of these sizes? Your Answer: 4/4 pts Question 7 List the 5 components needed to perform a PCR...
A linear fragment of DNA is cleaved with the individual restriction enzymes Hindill and Smal, and...
A linear fragment of DNA is cleaved with the individual restriction enzymes Hindill and Smal, and then with a combination of the two enzymes. The fragments obtained are: Eco RV 2 kb, 3.5 kb, 9.5 kb Bam HI 6 kb, 9 kb Eco RV and Bam H12 kb, 3.5 kb, 4 kb. 5.5 kb Draw a restriction map of the DNA fragment. (5 marks). Model of example restriction map to show you how to give your answer: Eco R1 Hind...
on the me but not with the larger fragments on o t and more and record med in the h 3. Determine the distracted for each bund data bere 4. Determine the distance traveled for each and generated in the double digest and record data bere tion Endonuclease Digestion and Gel Electrophoresis of DNA 185 VI. RESTRICTION MAPPING The different DNA fragments generated by different map DNA. For example, specific DNA on 2000 nucleotides in las Rl or Hind and...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...
1. How many fragments were
produced?
2. What is the size of the fragments?
Custom Digest NEW ENGLAND Print Close BioLabs NEBcutter unnamed sequence - digested with: Alul mment Gel Type: DNA Type: Unmethylated Marker: 1% agarose Lambda - Hindll Digest L=102 mm OK Length (bp) Ends Coordinates narker 1| (LeftEnd)-Alul 1-167 2Alul-(RightEnd) 217-308 3 Alul-Alul 167 92 49 10000 168-216 5000 1000 500 100
Unanswered Question 6 0/1 pts A restriction digest is performed on a plasmid. The table below shows the sizes of the resulting DNA fragments. 3 enzyme(s) present in the DNA size fragments digest resulting Pstl 10,000 base pairs (bp) Sspl 7,000 bp, 3,000 bp double digest, Estland 4,000 bp, 3,000 bp Sspl Explain the double digest results, what happened to create pieces of these sizes? Your Answer: 4/4 pts Question 7 List the 5 components needed to perform a PCR...
A linear fragment of DNA is cleaved with the individual restriction enzymes Hindill and Smal, and then with a combination of the two enzymes. The fragments obtained are: Eco RV 2 kb, 3.5 kb, 9.5 kb Bam HI 6 kb, 9 kb Eco RV and Bam H12 kb, 3.5 kb, 4 kb. 5.5 kb Draw a restriction map of the DNA fragment. (5 marks). Model of example restriction map to show you how to give your answer: Eco R1 Hind...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago