A sample of DNA was sequenced using the dideoxy nucleotide method, and the resulting (synthesized) products were resolved on the gel (shown here). What is the correct sequence of the synthesized DNA (=DNA that is shown on the gel) written 5’->3’ direction?
5’-AGTCA -3’
5’-TACGGACTGA -3’
5’-AGTCAGGCAT -3’
5’-ATGCCTGACT -3’
5’-TCAGTCCGTA-3’

I believe the correct answer to be:
Option C) 5’-AGTCAGGCAT -3’
As the 5' end is at the bottom and 3' incorporation is at the top of the gel.
feel free to leave a comment down below for any further query. good rating would be appreciated if you find my answer helpful. thank you.
A sample of DNA was sequenced using the dideoxy nucleotide method, and the resulting (synthesized) products...
Pleaae answer this with explanation asap.I would really apprecuate
it .
6. (4 points) Dideoxy sequencing of a fragment of DNA produces the gel pattern shown below, with the and+ to the left of the gel referring to the negative and positive electrodes of the gel, respectively. C T A G Which of the following statements about the gel products and the sequence of the DNA template are correct? The sequence of the template DNA is 5'-GACTCGACTGTACGTGC-3', te letter above...
ddATP ddCTP ddGTP ddTTP The autoradiogram shown was obtained from a DNA sequencing method called Sanger sequencing or dideoxy sequencing. The arrow shows the direction of migration of the DNA samples during electrophoresis. Determine the sequence of the DNA template strand, in the 5' to 3' direction, from this data. 5' – CGTCAATTTAG
Assume that the following single strand of DNA was synthesized using standard dATP, dGTP, dCTP, and dTTP precursors; however, the innermost phosphate (alpha phosphate) of all the dATPs was labeled with 32P. 3' - CTAGTAT - 5' Assume also that the strand was degraded to completion by the enzyme spleen diesterase. Spleen diesterase cleaves DNA at the covalent bond that connects the 5' carbon of the sugar to the phosphate. Which of the resulting nucleotide(s) might now carry the 32P?...
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred...
Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...
1. DNA Structure and Replication fill in the blanks. 10pts and , have two nitrogenous rings and are a. The bases, called direction and reads the b. DNA Polymerase synthesizes new DNA in the template DNA strand in the direction. c. DNA polymerases use -exonuclease activity to proofread newly synthesized DNA. Whereas, DNA Pol I uses _-exonuclease activity to remove RNA primers. d. The enzyme telomerase synthesizes using as a template. e. DNA Replication begins at the and two ,,...
7.. In the controlled termination method of DNA sequencing, reading the gel from _____ gives the sequence in the _____ direction; _____ fragments that were terminated _____ in polymerization move faster down the gel a. bottom to top; 5′ to 3′; shorter; early b. top to bottom; 5′ to 3′; longer; early c. bottom to top; 5′ to 3′; longer; later d. top to bottom; 5′ to 3′; shorter; early e. bottom to top; 3′ to 5′; shorter; early 8....
I just need the answers to questions 2 and 3. My DNA ladder is
in lane 2 with the yellow arrow pointing to it. Thanks!
Part 2: Gel purification and ration Gel Slice and PCR Product Preparation modified from IBSci.com instructions for gel and PCR clean-up system A. Dissolving the Gel Slice 1. Following electrophoresis, excise DNA band from gel and place gel slice in a 1.5ml microcentrifuge tube. 1b. Use an analytical balance to weigh gel slice. Record weight...
8. DNA cloning. The first DNA clone using recombinant DNA technology was human insulin, which was made in 1978. The insulin gene was inserted into a plasmid and the gene was transcribed and translated from the plasmid in E coll cells. Insulin is synthesized by ribosomes in human pancreatic cells. Insulin is synthesized as a longer polypeptide, which is then trimmed by proteases to make the mature chains A and B (see Fig. 2.17 on page 39 of your textbook)....
Chromosomal and plasmid DNA can be cut into manageable pieces by
restriction enzymes. Using agarose gel electrophoresis, the DNA
fragments can be separated on a gel, based on their lengths. In
order to see the fragments, a stain is typically added to the gel.
The size of each fragment can be determined by comparing each one
to a DNA molecular weight marker of known size.
Below is a map of pBR22 plasmid. The position and base pair
number of the...