Pleaae answer this with explanation asap.I would really apprecuate
it .
6) The sequence of DNA template is 5'-GCACGTACAGTCGAGTC-3'. The letter above each lane corresponds to dideoxy nucleotide that was included in the reaction whose products were run in that lane. (option c).
This is because, the bases in the DNA template strand will be complimentary to those observed in DNA strand.
5) The rate of occurrence of neurofibromatosis is higher than the rate of occurrence of retinoblastoma. This is because, the genes that are mutated to cause neurofibromatosis are more prone to DNA replication errors than those that mutated to cause retinoblastoma, because replication error rates can vary depending on the tissue the gene is found in (option c).
Pleaae answer this with explanation asap.I would really apprecuate it . 6. (4 points) Dideoxy sequencing...
9. (8 points) Use the figure below to answer the following questions about Sanger Dideoxy sequencing. GATC 11.1 This figure represents a portion of a polyacrylamide gel used to separate DNA fragments produced from a Sanger dideoxy DNA sequencing reaction. Write the sequence of the boxed portion of the newly synthesized (nascent) strand (in the 5' to 3' direction). Label the 5' and 3' ends of the DNA sequence. 11 il Write the DNA sequence of the complementary template strand...
Question 13 4 pts A fragment of DNA is cloned into a plasmid with a sequencing primer-binding site. After dideoxy sequencing, the gel pattern shown in this diagram is obtained. ddATP reaction ddTTP reaction ddCTP reaction ddGTP reaction What was the sequence of the DNA strand that acted as the template in the sequencing reaction? 5'ACGATCG 3' 5'TGCTAGC 3 5'CGATCGT3 5'GCTAGCA 3'
A sample of DNA was sequenced using the dideoxy nucleotide
method, and the resulting (synthesized) products were resolved on
the gel (shown here). What is the correct sequence of the
synthesized DNA (=DNA that is shown on the gel) written 5’->3’
direction?
5’-AGTCA -3’
5’-TACGGACTGA -3’
5’-AGTCAGGCAT -3’
5’-ATGCCTGACT -3’
5’-TCAGTCCGTA-3’
Question 4 0.5 pts A sample of DNA was sequenced using the dideoxy nucleotide method, and the resulting (synthesized) products were resolved on the gel (shown here). What is...
Please explain how to identify
which lane corresponds to which ddNTP.
44. For the Sanger sequencing of a template DNA sequence 3'-CATGGGCTTTAGTCCT-5', which lane of the agarose gel below represents the reaction mix containing ddATP? a) Lane A b) Lane B c) Lane C d) Lane D e) None of these lanes
3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing method. Below is the DNA sequence from a region of the vector. 5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’ 3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’ To which DNA strand does the primer bind, the top or bottom one? Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band)...
I got the last answer and it was wrong. Can you explain how you
get your answer please?
Below is a segment of an electrophorogram of a dideoxy sequencing gel. The origin is at the top. The positive pole is at the bottom of the segment. Each track was made by adding a dideoxy base (1 in 20) of the base indicated by the track name to the reaction mixture. What is the sequence of the TEMPLATE DNA used for...
please help with all three!
For DNA synthesis to take place in a Sanger sequencing reaction, the DNA polymerase must catalyze a reaction between the 3'- the last nucleotide and the 5- of the next nucleotide to be added. hydroxyl group, phosphate group O phosphate group, hydroxyl group O hydroxyl group, hydroxyl group O phosphate group, phosphate group QUESTION 6 millions of individual DNA fragments are isolated and sequenced in parallel during each machine run. O traditional whole-genome sequencing O...
Which of the following statements is correct concerning operon gene control? Positive control requires an activator protein to stimulate transcription of the structural genes within an operon. In negative control, a repressor protein inhibits or turns off transcription of the structural genes within the operon. An inducible operon normally is not transcribed. It requires an inducer molecule to stimulate transcription either by inactivating a repressor protein in a negative inducible operon or by stimulating the activator protein in a positive...
You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3) with radioactive labeled chain terminator nucleotides. Fragments were run on a polyacrylamide gel to read a sequence from 5’-----------3’ of the gene sequence. Fill each lane on the gel with bands which terminate with either A, C, G, or T nucleotide. Also, mark the size of the fragments in lane L. Write the complete sequences as you read off the gel. A C G T L
pls help ?
Font Q10B. You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3) with radioactive labeled chain terminator nucleotides. Fragments were run on a polyacrylamide gel to read a sequence from 5 3' of the gene sequence. Fill each lane on the gel with bands which terminate with either A, C, G, or I nucleotide. Also, mark the size of the fragments in lane L. Write the complete sequences as you read off the gel. (5 points)...