Microbiology questions: (Please answer all three if possible) Shown below is a partial sequence of an...
Microbiology questions: (Please answer all three if possible)
Shown below is a partial sequence of an RNA molecule. 5' GUACUAAGGAGGUG1 UGU2 GAUGAACCAAGUCUAGGG...
1. Could this be mRNA? Why or why not?
2. What determines whether or not a piece of RNA will be translated?
3. What is meant by "setting the frame"? Would the frame change if you deleted the base marked G1 on the sequence above? Why or why not?
Homework Answers
Ans:-
1) Yes it can be a mRNA since Uracin 'U' is present here instead of Thyamin 'T'.
2)RBS, START CODON, and Ribosoms.
3)Setting a frame means reading the frame by dividing the sequence of nucleotides in DNA or RNA into a set of consecutive, non-overlapping triplets.
Here the frame will not be changed if the G1 marked nucleotide deleted because it is not falling within the reading region.
Add Answer to:
Microbiology questions: (Please answer all three if
possible)
Shown below is a partial sequence of an...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
2) On your first day working in my lab, you obtain the following DNA sequence: 3'...
2) On your first day working in my lab, you obtain the following DNA sequence: 3' AATTATACACGATGAAGCTTGTGACAGGTTTCCAATCATTAA 5 5' TTAATATGTGCTACTTCGAACACTGTECCAAAGGTTAGTAATT 3' a) What are the two possible RNA molecules that could be transcribed from this DNA? Indicate the 5' and 3' ends of the RNA. b) Only one of these two RNA molecules can actually be translated. Explain why. c) It turns out that the RNA molecule that can be translated is the mRNA for p53. What is the amino...
please help with genetics !! 5. Translate the RNA sequence below using three possible reading frames....
please help with genetics !!
5. Translate the RNA sequence below using three possible reading frames. 5' AGUCUAGGCACUGA 3' If this segment of RNA is found in the middle of an mRNA for a large protein, would you know which reading frame was used? How? 6. For each of the following sequences, rank them in order as sequences that could be used for initiation in eukaryotes. 1=best, 4=worst 5' GACGCCAUGG 3' 5' GCCUCCAUGC 3' 5' GCCAUCAAGG 3' 5' GCCACCAUGG 3'
A segment of a double-stranded DNA molecule is shown below. The start of a gene is...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
Use the DNA sequence below and the genetic code in your text to answer the following...
Use the DNA sequence below and the genetic code in your text to answer the following questions. Template DNA 3ʹ T A A G C G A T A C G A G A 5ʹ Non-template DNA 5ʹ A T T C G C T A T G C T C T 3ʹ What is the RNA sequence that would be transcribed from the sequence above? Include the 3ʹ and 5ʹ ends. (0.5) b) What is the amino acid sequence...
I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions....
I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions. 11 21 31 41 51 71 81 61 91 CGTAATTGAG GAGGTAGTTG ACGTATGAAT AGTTAACGTA CGGGGGGGAA 101 111 121 131 141 ACCCCCCCTT TTTTTTTTTC GAGCAATAAA AGGGTTACAG ATTGCATGCT a) Write down the corresponding sequences, find them in the sequence above and label them: -35 Consensus sequence: _(label as -35) -10 Consensus sequence (Pribnow box): _ __ (label as Pribnow) Shine-Dalgarno sequence in corresponding mRNA: __ (label as SD)...
Shown below is the anti-sense DNA sequence from a region of a gene that produces a...
Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...
Below is a partial mRNA sequence. Use it to answer the following questions. 5 - UGGUCGGCGAGAACGAAAGCGC...
Below is a partial mRNA sequence. Use it to answer the following questions. 5 - UGGUCGGCGAGAACGAAAGCGC - 3 The amino acids in the original partial sequence (N-term-...V-G-E-N-E-S...-C-term) have little to no impact on protein structure and function, with the exception of serine. Phosphorylation of the serine residue is required for normal function of the protein. Given this information, which reversion mutation(s) in the gene would restore the normal function of the entire protein? Select the four correct answers. Deletion of...
Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’-...
Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...
Answer the questions: Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter ....
Answer the questions:
Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter . Facilitatord. Terminator Question 12 .A specific factor helps RNA polymerase binding to promoters and transcribe genes a Delta b. Beta Gamma d. Sigma Question 13 ............ Promoters lack a TATA box are referred to as TATA less promoters, for example operon Housekeeping genes b. Functional genesc d. Structural genes Question 14 0.5 points Save Answer During "RNA processing" All of the exons are a....
2) On your first day working in my lab, you obtain the following DNA sequence: 3' AATTATACACGATGAAGCTTGTGACAGGTTTCCAATCATTAA 5 5' TTAATATGTGCTACTTCGAACACTGTECCAAAGGTTAGTAATT 3' a) What are the two possible RNA molecules that could be transcribed from this DNA? Indicate the 5' and 3' ends of the RNA. b) Only one of these two RNA molecules can actually be translated. Explain why. c) It turns out that the RNA molecule that can be translated is the mRNA for p53. What is the amino...
please help with genetics !!
5. Translate the RNA sequence below using three possible reading frames. 5' AGUCUAGGCACUGA 3' If this segment of RNA is found in the middle of an mRNA for a large protein, would you know which reading frame was used? How? 6. For each of the following sequences, rank them in order as sequences that could be used for initiation in eukaryotes. 1=best, 4=worst 5' GACGCCAUGG 3' 5' GCCUCCAUGC 3' 5' GCCAUCAAGG 3' 5' GCCACCAUGG 3'
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions. 11 21 31 41 51 71 81 61 91 CGTAATTGAG GAGGTAGTTG ACGTATGAAT AGTTAACGTA CGGGGGGGAA 101 111 121 131 141 ACCCCCCCTT TTTTTTTTTC GAGCAATAAA AGGGTTACAG ATTGCATGCT a) Write down the corresponding sequences, find them in the sequence above and label them: -35 Consensus sequence: _(label as -35) -10 Consensus sequence (Pribnow box): _ __ (label as Pribnow) Shine-Dalgarno sequence in corresponding mRNA: __ (label as SD)...
Answer the questions:
Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter . Facilitatord. Terminator Question 12 .A specific factor helps RNA polymerase binding to promoters and transcribe genes a Delta b. Beta Gamma d. Sigma Question 13 ............ Promoters lack a TATA box are referred to as TATA less promoters, for example operon Housekeeping genes b. Functional genesc d. Structural genes Question 14 0.5 points Save Answer During "RNA processing" All of the exons are a....
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago