Homework Answers
Two contig from sequence
AAATTTCTATCTTATGGAGGCTAGGCTATAGCTAGCTAAGC
AGCTCTAGCCCTAAGCTCGATCCCTTAGCCCTAGGCTCGGATCC
Add Answer to:
1. Shotgun sequencing. Put the read together into a contig 1) atcttatggaggct ag 2) aaatttctatcttat 3)...
You create a genomic library and then preform shotgun sequencing to generate the following set of...
You create a genomic library and then preform shotgun sequencing
to generate the following set of 6 sequences (all orientated 5’ to
3’).
Based on these data, assemble the most likely sequence contig.
Provide the sequence and the order of sequence reads. What is the
difference between a sequence read and a sequence contig?
③TACGA ④CGATC
1. Assemble a 24 base DNA sequence from these sequence fragments, produced by shotgun sequencing? (Don't...
1. Assemble a 24 base DNA sequence from these sequence fragments, produced by shotgun sequencing? (Don't forget that sequences can occur from either direction with shotgun sequencing). GATGAC GACATGGC TCAGTCGA CGATGCG GGCGTCAG
6) Many scientists doubted that shotgun sequencing would work, even with the smallest genomes, because: a....
6) Many scientists doubted that shotgun sequencing would work, even with the smallest genomes, because: a. There would not be overlaps between the different mini-sequences. b. Computers would be unable to handle the huge amount of data generated by a shotgun sequencing project. c. Small prokaryotic genomes contain large amounts of repetitive DNA. d. No method existed for breaking genomic DNA into random fragments. 7) In a PCR-RFLP assay, enzyme digestion revealed three bands (152+187+462bp) in AA animals, four bands...
Read 3 articles related to fraud in accounting. 1. Put a summary of the article (2...
Read 3 articles related to fraud in accounting. 1. Put a summary of the article (2 pt) 2. put the url of where the article can be found(1 pt) 3. Indicate what you have learned? ( 2 pt)
Read 3 articles related to fraud in accounting. 1. Put a summary of the article (2...
Read 3 articles related to fraud in accounting. 1. Put a summary of the article (2 pt) 2. put the url of where the article can be found(1 pt) 3. Indicate what you have learned? ( 2 pt)
please help with all three! For DNA synthesis to take place in a Sanger sequencing reaction,...
please help with all three!
For DNA synthesis to take place in a Sanger sequencing reaction, the DNA polymerase must catalyze a reaction between the 3'- the last nucleotide and the 5- of the next nucleotide to be added. hydroxyl group, phosphate group O phosphate group, hydroxyl group O hydroxyl group, hydroxyl group O phosphate group, phosphate group QUESTION 6 millions of individual DNA fragments are isolated and sequenced in parallel during each machine run. O traditional whole-genome sequencing O...
Short and clear answers please! Thank you Question 2: Advances in DNA sequencing, 5 points A....
Short and clear answers please! Thank you
Question 2: Advances in DNA sequencing, 5 points A. 3 points. Imagine you are explaining the revolution in DNA sequencing to a relative. You're trying to explain to them why the price dropped one-million fold. The major key advance that lead to this drop in price is: B. 1 point. In Next Generation Sequencing, dsDNA linkers are added to each of the fragmented pieces of DNA. This linker enables the fragments to stick...
Three short sequence reads from a genomic library made by partial digestion with Sau 3Al and...
Three short sequence reads from a genomic library made by partial digestion with Sau 3Al and ligation into the Bam Hl site of plasmid vectors are shown below. Do all three of the following 20 nt sequence reads generate a single contig? If so, how long is that contig? (For the purpose of this question, 8 nt of sequence overlap is sufficient for any two reads to form a contig.) read 1: 5' AAAGTCAACCTGTATTGGCC 3 read 2: 5' GCGCGCTATAGGCCAATACA 3'...
You can improve the read length of Sanger Sequencing by changing the enzymatic activity of the...
You can improve the read length of Sanger Sequencing by changing the enzymatic activity of the original DNA Polymerase. a. Explain the problems with the DNA polymerase and the modifications required. [3 M] b. Name a commercial Sanger Sequencing DNA polymerase with properties in a) [1 M]
Just answer problem and put letter beside answer. 1/3 1/3 Payoff 1 Payoff 2 Payoff 3...
Just answer problem and put letter beside answer.
1/3 1/3 Payoff 1 Payoff 2 Payoff 3 1/3 4 0.30 Payoff 4 0.50 Payoff 5 Alternative A 0.20 Payoff 6 9 PayOff 7 2 1/3 1/3 1/3 PayOff 8 PayOff 9 Alternative B 5 0.30 Payoff 10 0.50 18 Payoff 11 0.20 PayOff 12 1/2 6 Payoff 13 3 1/2 PayOff 14 2 3 4 5 6 7 Payoff 1 $ 3 8 9 10 11 12 13 14 5 4...
You create a genomic library and then preform shotgun sequencing
to generate the following set of 6 sequences (all orientated 5’ to
3’).
Based on these data, assemble the most likely sequence contig.
Provide the sequence and the order of sequence reads. What is the
difference between a sequence read and a sequence contig?
③TACGA ④CGATC
6) Many scientists doubted that shotgun sequencing would work, even with the smallest genomes, because: a. There would not be overlaps between the different mini-sequences. b. Computers would be unable to handle the huge amount of data generated by a shotgun sequencing project. c. Small prokaryotic genomes contain large amounts of repetitive DNA. d. No method existed for breaking genomic DNA into random fragments. 7) In a PCR-RFLP assay, enzyme digestion revealed three bands (152+187+462bp) in AA animals, four bands...
please help with all three!
For DNA synthesis to take place in a Sanger sequencing reaction, the DNA polymerase must catalyze a reaction between the 3'- the last nucleotide and the 5- of the next nucleotide to be added. hydroxyl group, phosphate group O phosphate group, hydroxyl group O hydroxyl group, hydroxyl group O phosphate group, phosphate group QUESTION 6 millions of individual DNA fragments are isolated and sequenced in parallel during each machine run. O traditional whole-genome sequencing O...
Short and clear answers please! Thank you
Question 2: Advances in DNA sequencing, 5 points A. 3 points. Imagine you are explaining the revolution in DNA sequencing to a relative. You're trying to explain to them why the price dropped one-million fold. The major key advance that lead to this drop in price is: B. 1 point. In Next Generation Sequencing, dsDNA linkers are added to each of the fragmented pieces of DNA. This linker enables the fragments to stick...
Three short sequence reads from a genomic library made by partial digestion with Sau 3Al and ligation into the Bam Hl site of plasmid vectors are shown below. Do all three of the following 20 nt sequence reads generate a single contig? If so, how long is that contig? (For the purpose of this question, 8 nt of sequence overlap is sufficient for any two reads to form a contig.) read 1: 5' AAAGTCAACCTGTATTGGCC 3 read 2: 5' GCGCGCTATAGGCCAATACA 3'...
Just answer problem and put letter beside answer.
1/3 1/3 Payoff 1 Payoff 2 Payoff 3 1/3 4 0.30 Payoff 4 0.50 Payoff 5 Alternative A 0.20 Payoff 6 9 PayOff 7 2 1/3 1/3 1/3 PayOff 8 PayOff 9 Alternative B 5 0.30 Payoff 10 0.50 18 Payoff 11 0.20 PayOff 12 1/2 6 Payoff 13 3 1/2 PayOff 14 2 3 4 5 6 7 Payoff 1 $ 3 8 9 10 11 12 13 14 5 4...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago