In order for a human genomic DNA library to fully represent the entire genomic information content of humans, what type of methods must be employed to fractionate the human genomic DNA for making the library?
A gene library is a large collection of cloned DNA sequences from a single genome. A genomic library which contain at least one copy of every sequence in an organism’s genome, are used to investigate the structure of a given chromosome, or to clone specific genes. Genomic DNA libraries contain large fragments of DNA in either bacteriophages or bacterial or P1-derived artificial chromosomes (BACs and. PACs). In order for a human genomic DNA library to fully represent the entire genomic information content of humans, methods like recombinant DNA technology, cloning, DNA sequencing methods etc must be employed to fractionate the human genomic DNA for making the library. Various hosts like plasmids, bacteriophage lambdas, cosmids, YACs and many more are used to construct such genomic libraries.
In order for a human genomic DNA library to fully represent the entire genomic information content...
54. The advantage of a cDNA library of eukaryotic genes compared with a genomic library is that the cDNA library: a. always has the entire gene sequence b. lacks introns C. contains both introns and exons d. consists of single-stranded DNA e consists of RNA and DNA 55. Which of the following is an example of a cloning vector? a. Human growth hormone b. Mosquito c. Plasmid d. Tick e. Ribosomal RNA 56. Transformation in recombinant DNA technology: a. Requires...
Q14: In order to express a human protein in a bacterium, the complementary DNA (cDNA) of that human gene must be inserted into the bacterium rather than simply the gene cut out of genomic DNA. Please explain why.
command 145 Genetics Assignment Genomic Analysis 1. Some bacteria normally produce endonucleases for what purpose? a) necessary digestion of their own genome b) defense against viral infection c) bacteria never make endonucleases naturally 2. A blunt cutter produces DNA fragments with complementary overhanging regions. a) True b) False 3. Which of the following DNA sequences (when double-stranded) most likely represents a restriction endonuclease site for a 6-mer cutter? a) AGTAAGCTTC c) AGAGAGCCAA b) GGTAGATTCC d) None of the above 4....
Say you were to isolate and sequence the genomic information of microbes within a sample, how would you make use of this information to inform what type of growth medium to grow your microbes on? And, what other methods could you sue in order to learn more about the microbes present in your sample?
24. What would be the anticodon if the template strand of DNA Is ACC A UCC B.) TGG UGG D. ACC E. TCC 25. Prior to protein synthesis, the DNA A. attracts tRNAs with appropriate amino acids. 6.) serves as a template for the production of mRNA. C. adheres to ribosomes for protein synthesis. D. contains anticodons that become codons. E. must first undergo replication. 26. The Human Genome Project has revealed that human DNA has approximately A. 30,000 bases...
E. TAGGTGAAAGAAATCAGTTA UT EID: 4-38. The human RefSeg of the entire first exon of a gene involved in Brugada syndrome (a cardac disorder characterized by an abnormal electrocardiogram and an increased risk of sudden heart failure) is shown. The first exon includes the start codon. The genomic DNA of four people (1-4) was subjectesd to sequencing. The following sequences represent all those obtained from each person Nucledtides different from the RefSeq are underlined. RefSeq 5 CA ACG CTT AGG ATG...
There are two main types of cells in the human brain, neurons (nerve cells) and glial cells (supporting cells). Once neurons fully mature, these nerve cells no longer divide. Glial cells, however, continue to divide over a person’s entire lifetime. GDNF (glial cell line-derived neurotrophic factor) is a small protein that stimulates growth in glial cells. What kind of signal molecule is this protein? How does GDNF likely promote cell division? After the glial cell receives GDNF, what will happen...
1) You have two human liver cells (A and B) and you hypothesize that the insulin receptor gene in Cell A has a mutation in exon 1 and Cell B contains the wild type sequence. You extract genomic DNA from each of the cells. Of the following, what would be the most efficient (quick, precise and relatively cheap) way to test your hypothesis. a. Isolate protein from both cells, purify the insulin receptor, and determine the amino acid content. b. Sequence the...
Case One: Cloud Helps Fight Cancer Each minute one person in the United States dies from cancer—over half a million deaths per year. Thousands of scientists and physicians are working around the clock to fight cancer where it starts—in our DNA. DNA is a molecule present in our cells that carries most of the genetic instructions used in the development, functioning, and reproduction of all known living organisms. The information in DNA is stored as a code made up of...
In this assignment you will implement software for your local library. The user of the software will be the librarian, who uses your program to issue library cards, check books out to patrons, check books back in, send out overdue notices, and open and close the library. class Calendar We need to deal with the passage of time, so we need to keep track of Java. Declare this variable as private int date within the class itself, not within any...