Question

2. Study the table below that summarises the flow of genetic information in a cell, and answer the questions below: DNA helix

0 0
Add a comment Improve this question Transcribed image text
Answer #1

2.1) This theory is called as the 'central dogma'.

2.2)

Second DNA strand: CGC CGA ATG ATT (as per rules of Watson Crick base pairing)

mRNA: GCG GCU UAC UAA (as per rules of complimentarity, T is replaced with U in mRNA)

A: Coding strand (has same sequence as mRNA)

B: Non-coding strand (the template strand for mRNA)

C: 5'

D: 3'

E: 3'

F: 5'

2.3)

Protein: Ala Ala Tyr (stop)

If you find this answer helpful, kindly give it a thumbs up!

Add a comment
Know the answer?
Add Answer to:
2. Study the table below that summarises the flow of genetic information in a cell, and...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui...

    mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...

  • Lecture Homework Assignment (LHA) #3 BIO 2010 Microbiology Print Name: Section # Sequences of single strands...

    Lecture Homework Assignment (LHA) #3 BIO 2010 Microbiology Print Name: Section # Sequences of single strands of DNA are shown below for two different pieces of DNA. Assume that the DNA sequences are not at the beginning of a gene and that the spaces between each DNA triplet represent the correct reading frame, Label all sequences 5 and 3', where appropriate. Keep everything aligned properly. A Synthesize the complementary DNA sequence. B. Transcribe the mRNA sequence starting with the 5...

  • Microbiology: DNA-mRNA-tRNA translation . HELP ASAP of DNA are shown below for two different pieces of...

    Microbiology: DNA-mRNA-tRNA translation . HELP ASAP of DNA are shown below for two different pieces of DNA ces are not at the beginning of a gene and that the spaces Assume that thn me that the seq between ea 3 , where appropriate. Keep everything aligned properly. A. Synthesize the complementary DNA sequence ch DNA triplet represent the correct reading frame. Label all sequences 5' and e mRNA sequence starting with the 5 end on the left-hand side. C. Write...

  • Follow the instructions below to answer questions about Replication, Transcription & Translation. 3’- T   A   C...

    Follow the instructions below to answer questions about Replication, Transcription & Translation. 3’- T   A   C A   C   C   G   G   T   C   A   G   G   T   G A   T   C -5’ A. Imagine that the sequence shown represents one strand of a gene sequence. What would be the sequence of the complementary strand of DNA? Write out your answer, indicating correct polarity (5' and 3' ends) on your new strand. (1.5 points) B. Now imagine that the new strand...

  • Help Please. Due date-September 6, 2017 Bi042000-Problem Set #1 Name: 2. budy identified a new virus...

    Help Please. Due date-September 6, 2017 Bi042000-Problem Set #1 Name: 2. budy identified a new virus OHawk virus) that has an RNA genome and is causing the death of red tailed hawks in Manhattan. Upon further analysis of the Hawk virus Ife cycle, she found that the virus must synthesize DNA in order to replicate in Vero cells, which are susceptible and permissive for Hanwk virus a. Using your knowledge of the Baltimore classification system of viruses, draw a flow...

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • 1. Which of the following statements about the flow of genetic information is true? a. Proteins...

    1. Which of the following statements about the flow of genetic information is true? a. Proteins encode information that is used to produce other proteins of the same amino acid sequence. b. RNA encodes information that is translated into DNA, and DNA encodes information that is translated into proteins. c. Proteins encode information that can be translated into RNA, and RNA encodes information that can be transcribed into DNA. d. DNA encodes information that is translated into RNA, and RNA...

  • Overview The purpose of this activity is to help the students to understand how replication, tran...

    TranslationOverview:The purpose of this activity is to help the students to understand how replication, transcription, and translation are connected. Students will use a sequence from a bacterial gene that confers resistance to antibiotics (carbapenems). They will be asked to apply the knowledge obtained in the class lecture to (1) find the promoter in the sequence, (2) determine the amino acid sequence of a fragment of the polypeptide, (3) "reverse translate" a fragment of the polypeptide, and (4) identify mutations in...

  • 2 points Which of the statements below is false? * O The genetic code is universal....

    2 points Which of the statements below is false? * O The genetic code is universal. Degenerate codons specify the same amino acids. The genetic code is overlapping. O The genetic code is triplet. 2 points How many hydrogen bonds does cytosine form with guanine? * 2 3 O 4 2 points The amino acid sequence of a polypeptide chain comprises the structure of the protein. * primary secondary tertiary O quaternary 2 points One gene can have multiple effects...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT