Question

2 points Which of the statements below is false? * O The genetic code is universal. Degenerate codons specify the same amino
2 points How many hydrogen bonds does cytosine form with guanine? * 2 3 O 4 2 points The amino acid sequence of a polypeptide
2 points One gene can have multiple effects on an organism. * True O False 2 points The first mRNA codon to specify an amino
Which of the following is not a result 2 points of nondisjunction of the sex chromosomes? * Down syndrome Barr body Turner sy
Which mode of information transfer 2 points usually does not occur?* DNA to DNA DNA to RNA DNA to protein all occur in a work
0 0
Add a comment Improve this question Transcribed image text
Answer #1

The genetic code is not overlapping. That means adjacent codons do not share nucleotides. Hence statement, genetic code is overlapping is the wrong statement.

Cytosine and guinine have three hydrogen bonds in contrast to adenine and thymine which have two hydrogen bonds. Hence GC pair is stronger compared to AT pair. Hence correct option is three hydrogen bonds.

The amino acid sequence in a polypeptide is known as primary structure of the protein. Hence correct option is primary structure.

One gene can have multiple effects is true statement. This effect is known as pleiotrophy. This effect is seen when there is a mutation in a single gene which affects multiple traits.

Note: As per Chegg guidelines we are supposed to answer first four questions. Hence please re-post rest questions in a set of four questions. We would be happy to help you. Thank you.

Add a comment
Know the answer?
Add Answer to:
2 points Which of the statements below is false? * O The genetic code is universal....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 1.All cells in a human body undergo the process of meiosis. True False 2. Most cells...

    1.All cells in a human body undergo the process of meiosis. True False 2. Most cells in the human body contain 46 chromosomes. True False 3. The chances that any two siblings will be genetically identical is astronomically small. True False 4. Each time protein synthesis occurs; all of the DNA of a cell is copied. True False RNA creation occurs in the nucleus of a cell; protein synthesis occurs on the ribosomes. True False 6. Tay-Sachs syndrome is a...

  • can u tell me if these answers are correct please!??!!! Choose the best answer for the...

    can u tell me if these answers are correct please!??!!! Choose the best answer for the following questions. Place your answer on the line. If your answer is not on the line.it does not count 1 Mender's discovery that characteristics are inherited due to the transmission of hereditary factors resulted from his (1) dissections to determine how fertilization occurs in pea plants (2analysis of the offspring produced from many pea plant crosses (3) careful microscopic examinations of genes and chromosomes...

  • 1. Which of the following statements about the flow of genetic information is true? a. Proteins...

    1. Which of the following statements about the flow of genetic information is true? a. Proteins encode information that is used to produce other proteins of the same amino acid sequence. b. RNA encodes information that is translated into DNA, and DNA encodes information that is translated into proteins. c. Proteins encode information that can be translated into RNA, and RNA encodes information that can be transcribed into DNA. d. DNA encodes information that is translated into RNA, and RNA...

  • 24. What would be the anticodon if the template strand of DNA Is ACC A UCC...

    24. What would be the anticodon if the template strand of DNA Is ACC A UCC B.) TGG UGG D. ACC E. TCC 25. Prior to protein synthesis, the DNA A. attracts tRNAs with appropriate amino acids. 6.) serves as a template for the production of mRNA. C. adheres to ribosomes for protein synthesis. D. contains anticodons that become codons. E. must first undergo replication. 26. The Human Genome Project has revealed that human DNA has approximately A. 30,000 bases...

  • 21-1114 Date Transcription Kit Checklist Part 1: Making mRNA 1. Parts of a nucleotide: Approved Sugar...

    21-1114 Date Transcription Kit Checklist Part 1: Making mRNA 1. Parts of a nucleotide: Approved Sugar Phosphate Bases: Adenine Guanine Cytosine Uracil 2. One nucleotide Note: Omit 3-6 if not using the DNA Structure and Function Kit. 3. Separated DNA 4. Template DNA with one complementary nucleotide of RNA hydrogen bonded 5. Template DNA with strand of mRNA hydrogen bonded 6. Separated mRNA and duplex DNA molecule 7. Completed mRNA with cap and tail 8. The cap 9. The tail...

  • Hello, I just need someone to check my answer: The answer I choose are in bold...

    Hello, I just need someone to check my answer: The answer I choose are in bold points. 1. What was the most significant conclusion that Gregor Mendel drew from his experiments with pea plants? Recessive genes occur more frequently in the F1 generation than do dominant ones Traits are inherited in discrete units, and are not the results of "blending" There is considerable genetic variation in garden peas Genes are composed of DNA 2. In a particular plant, two genes...

  • DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...

    DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...

  • QUESTION5 2 points Saver There are two oategories of biologie theories of aging random aging and...

    QUESTION5 2 points Saver There are two oategories of biologie theories of aging random aging and programmed aging Match the theory below with ts appropriate category Cross-Iinking of DNA and protein A Random aging Free radical damage Programmed aging Telomere shortening Decline in immune function Wear and tea Limited number of cell divisions Biological clock Accumulation of arors QUESTION 6 as points Save Ans Normal cels grown in the laboratory do not age, but divide indefinitely True False QUESTION 7...

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT