Homework Help Question & Answers

1) The following DNA template is transcribed. What is the correct transcript? 3'-GGGTTTTCAGCG-5' 2) Compound X...

1) The following DNA template is transcribed. What is the correct transcript?

3'-GGGTTTTCAGCG-5'

2) Compound X is mutagen is a base analog that can be incorporated opposite either cytosine or thymine during replication. In subsequent rounds of replication, when DNA containing compound X is replicated, it always pairs with thymine. What type of mutation would you expect compound x to cause?

a. C : G -> T : A

b. T : A -> C : G

c. C : G -> G : C

d. C : G -> A : T

e. T : A -> G : C

0 0
Add a comment
Answer

This Homework Help Question: "1) The following DNA template is transcribed. What is the correct transcript? 3'-GGGTTTTCAGCG-5' 2) Compound X..." No answers yet.

Be the First!

Request Answer

Request answer!

We need 10 more requests to produce the answer to this homework help question. Share with your friends to get the answer faster!

0 /10 have requested the answer to this homework help question.

Request! (Login Required) Share with friends


Once 10 people have made a request, the answer to this question will be available in 1-2 days.
All students who have requested the answer will be notified once they are available.
Know the answer?
Add Answer to:
1) The following DNA template is transcribed. What is the correct transcript? 3'-GGGTTTTCAGCG-5' 2) Compound X...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coin

Coins can be redeemed for fabulous gifts.

Similar Homework Help Questions
  • നമ • 6. During transcription, the enzyme RNA polymerase: separates the two strands of a DNA...

    നമ • 6. During transcription, the enzyme RNA polymerase: separates the two strands of a DNA double helix O uses a gene in one DNA strand as a guide to make an mRNA molecule. 7. In the figure: - Write enzyme next to the name of the enzyme. - Trace the outlines of the DNA molecule. A/ACIC RNA polymerase adds one nucleotide at a time to the growing mRNA molecule. Each DNA nucleotide in the gene is matched with a...

  • Okazaki fragments are best described as: • • • • S A. cause by the DNA...

    Okazaki fragments are best described as: • • • • S A. cause by the DNA Helicase building in the 3' to 5' direction. B. short segments of replicated DNA formed on the lagging strand, C. short segments of DNA formed on the leading strand. D. caused by the single strand binding proteins moving in away from the replication fork. During Meselson and Stahl's experiment, E. coli was grown on heavy nitrogen for what purpose? • A. To determine how...

  • There is only ONE correct answer. Attached at the bottom is an information "Help" sheet that...

    There is only ONE correct answer. Attached at the bottom is an information "Help" sheet that may or may not contain useful information pertaining to this question. 19. The integrity of the genetic code relies on high-fidelity DNA replication, in which information in a template strand of DNA is transferred to the newly synthesized daughter strand (with A opposite T, and G opposite C). In class, we discussed the results of an experiment in which an unnatural thymine isostere called...

  • DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...

    DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

  • UNIT V Chapter 12, 13, & 14 WORKSHEET 1. 2. 3. 4. 5. 6. 7. DNA...

    UNIT V Chapter 12, 13, & 14 WORKSHEET 1. 2. 3. 4. 5. 6. 7. DNA gene Transcription Sugar. Phosphate Backbone Introns Semi-conservative tRNA DNA Ligase 8. 9. 10. rRNA Guanine Anti-codon 11. Deoxyribose A. Complementary to Cytosine B. With proteins makes up ribosomes C. 3 nucleotides on tRNA molecule that hydrogen bonds to codon D. Making an RNA copy of a DNA gene using the template strand E. Uprights (sides) of DNA "ladder" F. Part of a gene that...

  • UNIT V Chapter 12, 13, & 14 WORKSHEET DNA gene 1. 2. 3. 4. 5. 6....

    UNIT V Chapter 12, 13, & 14 WORKSHEET DNA gene 1. 2. 3. 4. 5. 6. 7. Transcription Sugar-Phosphate Backbone Introns Semi-conservative tRNA DNA Ligase A. Complementary to Cytosine B. With proteins makes up ribosomes C. 3 nucleotides on tRNA molecule that hydrogen bonds to codon D. Making an RNA copy of a DNA gene using the template strand E. Uprights (sides) of DNA "ladder" F. Part of a gene that gets spliced out during RNA processing G. Enzyme that...

  • 1. Which of the following statements is FALSE? Helicase activity 'unwinds DNA making the double-stranded molecule...

    1. Which of the following statements is FALSE? Helicase activity 'unwinds DNA making the double-stranded molecule into single strands. b. The leading strand of DNA is started by an RNA primer The lagging strand of DNA is synthesized as "Okazaki fragments", cach with its own RNA primer. DNA replication proceeds in both directions around the bacterial chromosome. DNA polymerase synthesives new DNA in one direction (3 to 5) only. 2. Which of the following would be found in eukaryotes? a....

  • 4. In a lake governed by the food web shown in the image to the right, 500 brown trout are added from fisheries. Which of the following outcomes would most likely be expected? A. Tadpole populat...

    4. In a lake governed by the food web shown in the image to the right, 500 brown trout are added from fisheries. Which of the following outcomes would most likely be expected? A. Tadpole population will increase B. Duck population will decrease C. Algae population will increase D. Lilly Pad population will decrease E. Caddis Fly larvae will increase 5. Which of the following pieces of evidence most strongly supports a common ancestor of all life on Earth? A....

  • can u tell me if these answers are correct please!??!!! Choose the best answer for the...

    can u tell me if these answers are correct please!??!!! Choose the best answer for the following questions. Place your answer on the line. If your answer is not on the line.it does not count 1 Mender's discovery that characteristics are inherited due to the transmission of hereditary factors resulted from his (1) dissections to determine how fertilization occurs in pea plants (2analysis of the offspring produced from many pea plant crosses (3) careful microscopic examinations of genes and chromosomes...

Free Homework App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.