Question

The enzymes required for protein synthesis of the amino acid tryptophan in E. coli are all...

The enzymes required for protein synthesis of the amino acid tryptophan in E. coli are all encoded in a single transcription unit, the trp operon. Transcription of the trp operon is only ignited when the cell has low levels of free tryptophan. Briefly describe how initiation of transcription of the trp operon is regulated in response to the availability of free tryptophan.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

In the absence or low level of tryptophan , the operator region of the operon is open as the tryptophan regulatory repressor molecule is inactive , thus free the site of operator for polymerase to carry out the function. When the tryptophan concentration increases as it act as corepressor it bind to apprepressor and bind to operator blocking the operon function. Thus the low level of tryptophan active the normal on trp operon.

Add a comment
Know the answer?
Add Answer to:
The enzymes required for protein synthesis of the amino acid tryptophan in E. coli are all...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Methionine is an amino acid made by E coli. The met (methionine) operon in E. coli...

    Methionine is an amino acid made by E coli. The met (methionine) operon in E. coli responds to a repressor protein which itself is: a. encoded by the operon b. turned off when bound to methionine c. turned on when bound to methionine d. unresponsive to any product of the methionine biosynthetic pathway e. turned on when bound to tryptophan

  • 3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect...

    3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect tryptophan biosynthesis. The first mutation is a single nucleotide substitution that converts the second tandem Trp codon in region 1 of the Trp leader sequence into a stop codon (see slides 2-7 of Lecture 24 on iLearn) trp structural genes trpE trpD trpC trpB trpA PO Trp Leader Met-Lys-Ala-lle-Phe-Val-Leu-Lys-Gly-Trp-Trp-Arg-Thr Ser- Stop Assume that strain 401 also contains a mutation in the gene for the...

  • Yet, all the cells in your body contain the same genes (and same alleles). The difference...

    Yet, all the cells in your body contain the same genes (and same alleles). The difference across cell types is that genes get selectively expressed (turned on or off) based on the proteins needed for cellular function given their environment. Select which statement explains the reason why hair does not normally grow on your muscle cells. a. Muscle cells have the gene for keratin, but do not express it b. Muscle cells do not have the gene for keratin and...

  • 7. In bacteria the elongation stage of protein synthesis does not involve: A) aminoacyl-tRNAS B) EF-Tu...

    7. In bacteria the elongation stage of protein synthesis does not involve: A) aminoacyl-tRNAS B) EF-Tu C) GTP D) IF-2 E) peptidyl transferase Which of the following best describes the cholesterol molecule? A) Amphipathic B) Nonpolar, charged C) Nonpolar, uncharged D) Polar, charged E) Polar, uncharged The enzyme that attaches an amino acid to a tRNA (aminoacyl-tRNA synthetase): A) always recognizes only one specific tRNA. B) attaches a specific amino acid to any available tRNA species. C) attaches the amino...

  • Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected...

    Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase should be used only once. promoter translation pause site RBS sigma factor tmRNA RNA polymerase stop codon transcription Rho factor ribosome start codon DNA polymerase attenuation tRNA The first step in gene expression is by to make an mRNA that encodes for one or more proteins. This requires...

  • 1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with...

    1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5-Bromouracil such that mutations were induced at Trp codons. Would you expect that these mutations would results in a non-sense mutation, a silent mutation, a missense mutation. Explain your answer.What is a tautomeric shift and explain how it contributes to transition mutations? 2.Draw the structure of the rare tautomeric enol form of guanine. Draw the structure of the monophosphate deoxynucleotide which...

  • 2. Suppose you have six strains of E. coli. One is wild type, and each of the other five has a single one of the follow...

    2. Suppose you have six strains of E. coli. One is wild type, and each of the other five has a single one of the following mutations: lacZ, lacY, laď·0; and lach. For each of these six strains, describe the phenotype you would observe using the following assays. Explain your answers. [Notes: (1) IPTG is a colorless synthetic molecule that acts as an inducer of lac operon expression but cannot serve as a carbon source for bacterial growth because it...

  • Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work...

    Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...

  • 11. What is the first amino ackd of any initial protein that is A. Valine C....

    11. What is the first amino ackd of any initial protein that is A. Valine C. Lysine D. Tryptophan E. Methionine 12. Choose all that apply. Polymerase Chain Reaction (PCR) can be used to A Create a DNA profile of suspects, victims, and criminals during crime scene investigations B. Duplicate pieces C. Help determine paternity D. Stimulate cell division E. Stimulate gene expression of DNA into many copies using a special form of DNA polymerase 13. What occurs during transcription?...

  • Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...

    Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT