Question

Write the sequences of the two 12-residue primers that could be used to amplify the following...

Write the sequences of the two 12-residue primers that could be used to amplify the following DNA segment by PCR.

ATAGGCATGGCCTTAAACGCTAGCTTGCAACGTTACGGTCAATGCCGTAACGTTGCA

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The forward primer and reverse primers are the two primer sequences that can be used to amplify a DNA segment.

The forward primer is complementary to antisense strand of a DNA, which means its sequence is same as the given DNA sequence.

Since we are to find primers of length 12, so the 12 - residues long forward primer has the following sequence :

ATAGGCATGGCC

The above sequence is in 5' - 3' direction, assuming that the DNA sequence provided by you is also in the 5' - 3' direction.

For the case of reverse primer, its sequence is complementary to the sense strand, but in a direction of 5' - 3'.

So this gives the following sequence for the reverse primer :

TGCAACGTTACG

Add a comment
Know the answer?
Add Answer to:
Write the sequences of the two 12-residue primers that could be used to amplify the following...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence...

    Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence using PCR. Note: Both strands shown below. 5'-CCACTAGGGAGCTACGTAGGCACGGCATTACACGGATAGGCATTAACG-3' 3'-GGTGATCCCTCGATGCATCCGTGCCGTAATGTGCCTATCCGTAATTGC-5' Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence using PCR. Note: Both strands shown below 5'-CCACTAGGGAGCTACGTAGGCACGGCATTACACGGATAGGCATTAACG-3 3'-GGTGATCCCTCGATGCATCCGTGCCGTAATGTGCCTATCCGTAATTGC-5 5'-CCACTAG-3'; 5'-CGTTAAT-3' 5'-GGTGATC-3'; 5'-GCAATTA-3' 5'-GATCACC-3':5'-CGTTAAT-3' 5'-CCACTAG-3';5'-GCAATTA-3' 5'-GGTGATC-3';5'-CGTTAAT-3'

  • S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel...

    S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...

  • Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence...

    Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence using PCR. Note: Both strands shown below.   5'-GGTGATCGGAGCTACGTAGGCACGGCATTACACGGATAGGCTAATTGC-3'   3'-CCACTAGCCTCGATGCATCCGTGCCGTAATGTGCCTATCCGATTAACG-5' 5'-CCACTAG-3' ; 5'-GCAATTA-3' 5'-GATCACC-3' ; 5'-CGTTAAT-3'    5'-GGTGATC-3' ; 5'-GCAATTA-3' 5'-CCACTAG-3' ; 5'-CGTTAAT-3' 5'-GGTGATC-3' ; 5'-CGTTAAT-3'

  • Which of the following components is NOT used in the technique of PCR to amplify a...

    Which of the following components is NOT used in the technique of PCR to amplify a specific DNA sequence in a mouse genome? O Specific single-stranded DNA primers O Double-stranded genomic mouse DNA O Heat-stable DNA polymerase D DNA ligase

  • The DNA primers used in PCR are a. complementary to DNA sequences at both ends of...

    The DNA primers used in PCR are a. complementary to DNA sequences at both ends of the DNA sequence of interest. b. attached to the gene of interest by ligase. c. produced when a gene of interest is read by restriction enzymes. d. identical to the entire base sequence of one strand of the DNA.

  • CHAPTER 14: Identify the primer sequences that could be used in this PCR reaction shown below...

    CHAPTER 14: Identify the primer sequences that could be used in this PCR reaction shown below to amplify the target region highlighter in pink (which could be an important gene such as insulin that you want to make many copies of). At this point, the double-stranded DNA has been heated so that the strands are now in a single-strand formation. Be sure to pay attention to the DNA sequence and the 5' 3'ends of the primers. 5' GG CCA A...

  • Choose the two primers from the list that will amplify the region indicated by the bracket....

    Choose the two primers from the list that will amplify the region indicated by the bracket. The PCR product should be 25 base pairs long. (The DNA has dotted lines every 5 base pairs to help with counting.) Choose TWO correct primers 4 points possible 5' ...TTTTGAAGGCCACACTTTCCCTCTCAAAGGCCCGGAACCC... 3' 3' ...AAAACTTCCGGTGTGAAAGGGAGAGTTTCCGGGCCTTGGG... 5' region to be amplified If image does not load, click here to access. 5'GGAAA 3 5'CCGGG 3 5'GAGAG 3 5'CACAC 3' a 5'CCTTT 3 n 5'TTTTG 3 5'TTCCG 3...

  • 1) You want to amplify the DNA between the two stretches of sequence shown below. What...

    1) You want to amplify the DNA between the two stretches of sequence shown below. What are the sequences of primers you would use to amplify this DNA? How many different combinations of primers can you use? DNA to be amplified 5'-GACCTGTGGAAGC- 3'-CTGGACACCTTCG CATACGGGATTGA-3 -GTATGCCCTAACT-5'

  • 1. Create the primers to amplify the gene of interest. 1. Below is almost the full...

    1. Create the primers to amplify the gene of interest. 1. Below is almost the full sequence of the coding strand of the F9 gene (exon 2-exon4) that you found in the online database (NCBI, Genomic sequence F9 gene). Some of the sequence is missing, but you know how many nucleotides are skipped. Design forward and reverse primers 18nt each for PCR that will isolate EXACTLY the sequence that is in bold typeface. Exon 2 = 164 nt Intron 2...

  • Which is not one of the elements needed to amplify DNA by polymerase chain reaction (PCR)?...

    Which is not one of the elements needed to amplify DNA by polymerase chain reaction (PCR)? Question 16 options: A) Nucleoside triphosphates that serve as the source of the nucleotides A, T, C, and G needed in the synthesis of the new strands of DNA B) A restriction endonuclease enzyme that cleaves DNA at specific locations C) The segment of DNA that must be copied D) A DNA polymerase enzyme that will catalyze the synthesis of a complementary strand of...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT