Polyoma viruses generate three types of T antigens from a single gene. The three T antigens...
Polyoma viruses generate three types of T antigens from a single gene. The three T antigens share some amino acid sequences, but other parts are completely different. Explain the mechanism by which this occurs.
Homework Answers
Polyoma viruses tumor antigens (T antigens) commonly target a key enzyme protein phosphatase 2A (PP2A). T antigen is encoded by a conserved domain called LT-stabilization domain (LSD). The three different types of T antigens are produced by alternative translation from alternative translational start sites. Alternative starts bring diversity as well as some commonality in alternatively translated proteins which makes them so unique and different bringing multiplicity of functional proteins (isoforms). Translation othe antigens starts (read) from different parts of the same gene. Other than alternative start of translation alternative splicing is the mechanism to bring resuffling of the aminoacid sequences to bring variation with unique domains.
Add Answer to:
Polyoma viruses generate three types of T antigens from a single
gene. The three T antigens...
Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What...
Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What do they have in common? (c) How are they different? 2. A geneticist found that a particular DNA mutation had no effect on the protein coded by a gene. What kind of mutation was this? Why? 3. (a) Name one amino acid that has more than one codon. (b) Name an amino acid that has only one codon 4. Look at the following sequence:...
Nucleic acid molecules have been isolated from seven types of viruses. The base composition of these...
Nucleic acid molecules have been isolated from seven types of viruses. The base composition of these molecules is shown in the table below but the data are incomplete regarding the composition of the nucleic acid, which is given in terms of the percentage of total base composition Virus Type Base 1 2 3 4 5 6 7 T 12 - 20 18 26 23 T 12 18 0 26 0 18 C 38 - 30 26 - 24 28 G...
A Mutation in the Myostatin Gene Increases Muscle Mass and Enhances Racing Performance in Heteroz...
Can someone please help me with numbers 4 and 5?
A Mutation in the Myostatin Gene Increases Muscle Mass and Enhances Racing Performance in Heterozygote Dogs Assignment 2 Below are the sequences of wildtype and mutant alleles of the myostatin gene discussed in the paper introduction Wildtype Allele: AATTACTGCTCTGGAGAGTGTGAATTTGTG Mutant Allele: AATTACTGCTCTGGAGAGTGAATTTGTGTT 1) Using the genetic code table (provided on page 2) and single-letter code for amino acids, write the amino acid sequences of both predicted proteins 2) What might...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dyst...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...
2.16. Which of the following partial amino acid sequences from a protein whose gene you wish...
2.16. Which of the following partial amino acid sequences from a protein whose gene you wish to clone would be most useful in designing an oligonucleotide probe to screen a cDNA library? (a) Met-Leu-Arg-Leu (b) Met-Trp-Cys-Trp Explain why.
8. (6) There are three common types of point mutations that can affect the coding sequence...
8. (6) There are three common types of point mutations that can affect the coding sequence of proteins. What are these mutations? How do the mutations change the mRNA sequence and consequently the protein? 9. (2) If you were to suggest gene therapy to the family, how you describe what the main goal of this therapy is? 10. (2) Different virus have been used as vectors for gene therapy. Andenoviruses are one example that have been used in humans. What...
The Bromomosaic virus (BMV), which infects barley and some other plants, is a single-stranded RNA virus...
The Bromomosaic virus (BMV), which infects barley and some other plants, is a single-stranded RNA virus with three genomic RNAs that each have a specific amino acid attached to the 3' hydroxyl group of the RNAs. The amino acid is attached to the RNA through the carboxyl group, similar to the bonding that an amino acid exhibits when charging a tRNA. Propose a mechanism for the attachment of the amino acid onto newly replicated BMV RNA. What would this imply...
3. antibody diversity is generated by multiple mechanisms, each of which contributes to the generation of...
3. antibody diversity is generated by multiple mechanisms, each of which contributes to the generation of antibodies with a multitude of different amino acid sequences in their antigen-binding sites. several of these mechanisms involve changes in the dna sequences encoding the antibody heavy and light chain proteins. one mechanism that does not rely on changes to the dna within the immunoglobulin heavy and light chain gene loci is, but is instead dependent on: a) the random usage of kappa light...
Human blood types A, B and O are associated with the carbohydrate antigens A, B and...
Human blood types A, B and O are associated with the carbohydrate antigens A, B and H respectively. A and B antigens are caused by an alteration of H antigen. Normally everyone can synthesize H antigen (a cell surface carbohydrate found on red blood cells and other cell types). Some people make A and/or B transferase(s) which converts the H antigen to an A and/or B antigen respectively. The H antigen is produced by a specific fucosyltransferase encoded by the...
ΦC31 is a type of bacteriophage that infects Streptomyces bacteria. One gene in the bacteriophage genome...
ΦC31 is a type of bacteriophage that infects Streptomyces bacteria. One gene in the bacteriophage genome specifies a recombinase called ΦC31 integrase that works through a mechanism slightly different from that of the recombinase shown in Fig. 6.30. Most importantly, the two target DNA sequences are different from each other. One called attP is 39 base pairs and is found on the circular bacteriophage chromosome, while the other—attB—is 34 base pairs long and is located on the much larger circular...
Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What do they have in common? (c) How are they different? 2. A geneticist found that a particular DNA mutation had no effect on the protein coded by a gene. What kind of mutation was this? Why? 3. (a) Name one amino acid that has more than one codon. (b) Name an amino acid that has only one codon 4. Look at the following sequence:...
Nucleic acid molecules have been isolated from seven types of viruses. The base composition of these molecules is shown in the table below but the data are incomplete regarding the composition of the nucleic acid, which is given in terms of the percentage of total base composition Virus Type Base 1 2 3 4 5 6 7 T 12 - 20 18 26 23 T 12 18 0 26 0 18 C 38 - 30 26 - 24 28 G...
Can someone please help me with numbers 4 and 5?
A Mutation in the Myostatin Gene Increases Muscle Mass and Enhances Racing Performance in Heterozygote Dogs Assignment 2 Below are the sequences of wildtype and mutant alleles of the myostatin gene discussed in the paper introduction Wildtype Allele: AATTACTGCTCTGGAGAGTGTGAATTTGTG Mutant Allele: AATTACTGCTCTGGAGAGTGAATTTGTGTT 1) Using the genetic code table (provided on page 2) and single-letter code for amino acids, write the amino acid sequences of both predicted proteins 2) What might...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...
Human blood types A, B and O are associated with the carbohydrate antigens A, B and H respectively. A and B antigens are caused by an alteration of H antigen. Normally everyone can synthesize H antigen (a cell surface carbohydrate found on red blood cells and other cell types). Some people make A and/or B transferase(s) which converts the H antigen to an A and/or B antigen respectively. The H antigen is produced by a specific fucosyltransferase encoded by the...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago