



Hello! If you could just show the steps on either on of these questions on which...
III. Subclone the gene into plasmid, extract the plasmid DNA. 5. You know that your insert (gene of interest, GOI) is flanked by the EcoRI sites, which makes this restriction enzyme a perfect candidate to cut out your gene. You also know that the GOI has a unique BamH1 restriction site. After subcloning the PCR product into the plasmid, a purified DNA preparation of the plasmid is digested to completion with BamHI restriction endonuclease. In separate reactions, the same preparation...
You are given a circular DNA molecule to analyze that is 3,000bp
(3 Kb) long. You proceed to treat the DNA molecule with different
cutting enzymes and then you run the individual reactions on a gel.
The following gel is produced with each column representing a
different reaction (lane). In lane 1 a molecule weight ladder is
run. In lane 2, the circular DNA is NOT treated with any enzyme. In
lane 3 the DNA is treated with an enzyme...
can
someone explain throughly on how to find a-c??? thanks!!!
The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...
Hi I have a problem with number 5, it involves gel
analysis results. There are 2 parts, a,b,c. For A Im sure you need
to make a graph with distance in (cm) on the vertical axis and
log10 bp on the horitzontal. I need help figuring out where to
start and what to do. Please help!
The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
Actual gels don't have labels. Here, the labels have been removed, but the ladder remains the same as in the previous example. 6. On the gel to the right, write the approximate size of each DNA fragment. Write the sizes next to each appropriate band. 7. Imagine that you have a sample of DNA that contains a single, specific DNA sequence. Before you run your gel, you split your sample into two tubes. You run the DNA from the first...
please help if you can
3. You cloned a 20 kb piece of DNA, which contains restriction sites as shown below. 281534 5 B 4 & 5 B = BamHl site, E = EcoRI site, H = Hindill site Numbers above the segments represent the sizes of the regions in kb. Draw and label (in the agarose gel below) the sizes of the fragments you would expect to see after complete digestion of this piece of DNA with the following...
A. Your lab To see if you understand what you did in our lab, answer the following based in the procedures for the restriction digest and the gel electrophoresis. 1. Using the PGLO map on p7 of the gel electrophoresis procedure, predict the size of the fragments generated by each enzyme EcoRI Hindill, and Pst! (the sizes you would expect to see on the gel.) (6 pts) Hindill -8 fragments were produced by the restriction enzyme. 2. Answer the calculation...
Hi can someone help me understand part C and why the
drawn in red lines are where they are.
Basically from the bp given how can I go back to cm so I can
drawn them into the picture provided?
Do not need help with A or B.
The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...