Which of the following is used to shuttle and donate an amino group during ammonia incorporation?...
Which of the following is used to shuttle and donate an amino group during ammonia incorporation?
serine
lysine
cysteine
tryptophan
glutamate
Homework Answers
The alpha-amino group of most of the amino acids are transferred
to form Glutamate from the 
-keto glutamate. By this process ammonia ion is achieved through
Oxidative deamination of Glutamate.
Hence, the Glutamate is used to shuttle and donate an amino group during ammonia incorporation.
Add Answer to:
Which of the following is used to shuttle and donate an amino
group during ammonia incorporation?...
Which of the following amino acid residues are often involved in proton transfers in enzyme-catalyzed reactions?...
Which of the following amino acid residues are often involved in proton transfers in enzyme-catalyzed reactions? Select one: Histidine, aspartate, lysine, and serine Histidine, aspartate, glutamate, arginine, and lysine. Glutamine, asparagine, lysine, and tyrosine Histidine, aspartate, serine, and cysteine Serine, tyrosine, arginine, and cysteine
Which of the following amino acids has an aliphatic R group? Which of the following amino...
Which of the following amino acids has an aliphatic R group? Which of the following amino acids has an aliphatic R group? tyrosine, leucine ,serine cysteine asparagine
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
1. Which complication is likely as a result of a condition known as metabolic syndrome? A....
1. Which complication is likely as a result of a condition known as metabolic syndrome? A. developing resistance to insulin B. developing type 1 diabetes C. developing cardiovascular disease D. developing both cardiovascular disease and resistance to insulin E. developing both type 1 diabetes and cardiovascular disease 2. Which amino acids are coded for by a single codon? A. methionine only B. Isoleucine only C. methionine and isoleucine D. methionine and tryptophan E. methionine, isoleucine, and tryptophan 3. Ubiquitin is...
26. Which of the following classification does not match the amino acid side chain A) Contains an basic group/ lysi...
26. Which of the following classification does not match the amino acid side chain A) Contains an basic group/ lysine B) It is polar C) Forms disulfide bond/ cysteine D) Forms hydrogen bonds with neighbors/ alanine serine 27. All amino acids found in proteins are L-amino acids EXCEPT the achiral. A) glutamate B) Lysine C) glyeine D) Alamine 28. The plH at which the positive and negative charges of an amino acid balance each ofher is called the A) isotonic...
1. When amino acids are degraded the first step is to remove the amino group. To...
1. When amino acids are degraded the first step is to remove the amino group. To which of the following molecules is the amino group typically transferred? A. Pyruvate B. Oxaloacetate C. Fumarate D. Alpha-ketoglutarate 2. Most amino acid degradation takes place in the ... A. Adipose B. Muscle C. Liver D. Epithelium 3. Urea contains two nitrogen atoms. What is the source of these two nitrogen atoms? A. Both from NH4+ B. NH4+ and aspartate C. NH4+ and serine...
Fill in the blanks for each amino acid Amino Acid Properties Name of R-group Properties Amino...
Fill in the blanks for each amino acid
Amino Acid Properties Name of R-group Properties Amino Acid Type of Polarity pKa Charge at Special functional group pH-7 Properties (hn(wpp)amgies applicable) (whpee Alanine Arginine Asparagine Aspartate Carboxyl Polar 3.9 Sulfhydryl Polar N/A Forms S-S Glutamine Glutamate Histidine Isoleucine Lysine Methionine Phenylalanine Aromatic Non-Polar Absorbs G@ 280 nm N/A Proline Can be Serine Threonine Tryptophane Tyrosine Valine
There are amino acid residue at the following positions: Arginine - 136 Valine - 58 Glycine...
There are amino acid residue at the following positions: Arginine - 136 Valine - 58 Glycine - 235 Glutamate - 97 Which of the following amino acid substitutions would be least likely to affect the activity of this enzyme? Why? A. Tryptophan at position 235 B. Aspartate at position 58 C. Lysine at position 136 D. Asparagine at position 97
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
BIOCHEM: Ammonia is incorporated into amino acids via which of the following? A) glutamate B) glutamine...
BIOCHEM: Ammonia is incorporated into amino acids via which of the following? A) glutamate B) glutamine C) both A and B D) none of the above
Which of the following amino acid residues are often involved in proton transfers in enzyme-catalyzed reactions? Select one: Histidine, aspartate, lysine, and serine Histidine, aspartate, glutamate, arginine, and lysine. Glutamine, asparagine, lysine, and tyrosine Histidine, aspartate, serine, and cysteine Serine, tyrosine, arginine, and cysteine
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
26. Which of the following classification does not match the amino acid side chain A) Contains an basic group/ lysine B) It is polar C) Forms disulfide bond/ cysteine D) Forms hydrogen bonds with neighbors/ alanine serine 27. All amino acids found in proteins are L-amino acids EXCEPT the achiral. A) glutamate B) Lysine C) glyeine D) Alamine 28. The plH at which the positive and negative charges of an amino acid balance each ofher is called the A) isotonic...
Fill in the blanks for each amino acid
Amino Acid Properties Name of R-group Properties Amino Acid Type of Polarity pKa Charge at Special functional group pH-7 Properties (hn(wpp)amgies applicable) (whpee Alanine Arginine Asparagine Aspartate Carboxyl Polar 3.9 Sulfhydryl Polar N/A Forms S-S Glutamine Glutamate Histidine Isoleucine Lysine Methionine Phenylalanine Aromatic Non-Polar Absorbs G@ 280 nm N/A Proline Can be Serine Threonine Tryptophane Tyrosine Valine
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago