Question

19. In the eukaryotic gene shown below, P = promoter, black boxes indicate exons and white boxes with stars (*) indicate intr17. Below is part of one of the strands of DNA being replicated with a primer already in place. 5-AGGTAGACGAACTCGGAG-3 CUGC

0 0
Add a comment Improve this question Transcribed image text
Answer #1

19. The segments c,e,g and i i.e., the exons will be included in the final mRNA.

Introns and exons are nucleotide sequences within a gene. Introns are removed by RNA splicing as RNA matures, meaning that they are not expressed in the final messenger RNA (mRNA) product, while exons go on to be covalently bonded to one another in order to create mature mRNA.

Not only do the introns not carry information to build a protein, they actually have to be removed in order for the mRNA to encode a protein with the right sequence. If the spliceosome fails to remove an intron, an mRNA with extra "junk" in it will be made, and a wrong protein will get produced during translation.Exons TTTTTTTTTTTTTT A AAA 3 -Introns ed splicing s! G AAAA 3 Mature mRNA

17. T

The first nucleeotide DNA polymerase will add is 'T'.

The synthesis always occur in 5' -3' direction (New strand is synthesised in 5'-3' direction so replication start at the 3, end of the existing DNA strand. Here the larger strand is DNA strand and the small uniit if primer.Here the primer is already attached to a position .So the next nuleotide attaches next to the primer .Here the next nucleotide in DNA is 'A' so it's complimentary nucleotide is 'T'. Hence the answer is 'T'À GGTAGAQCGAA CTCGGAG- 3 I CU GCUUGAT Shopping Shui e Synthes ng Entrance Exam

Add a comment
Know the answer?
Add Answer to:
19. In the eukaryotic gene shown below, P = promoter, black boxes indicate exons and white...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...

    4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...

  • 3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic...

    3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...

  • Shown below is the structure of an Arabidopsis gene, divided into 10 segments, designated A-J. The...

    Shown below is the structure of an Arabidopsis gene, divided into 10 segments, designated A-J. The gene contains three exons, two introns, a promoter, and a site in I for poly(A) addition. Exgn 1 Expn 2 Ep 3 Promorer Intron 1 Intran 2 AATAA a) What segment or segments of the gene will be represented in the initial RNA transcript? List the appropriate letter or letters. (2 pts) b) What segment or segments of the gene will be found in...

  • table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are...

    table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...

  • A segment of a double-stranded DNA molecule is shown below. The start of a gene is...

    A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...

  • hello, two of these circled answers are incorrect. 1 6. The promoter sequences are the positions...

    hello, two of these circled answers are incorrect. 1 6. The promoter sequences are the positions that: signal the initiation site of a gene (+1) B) bind the transcriptional factor that is associated with RNA polymerase e) attach the correct nucleotide triphosphate to the template DNA strand D) separate the two DNA strands CUA 7. A particular triplet of bases in the coding sequence of DNA is GAT. The anticodon on the tRNA that binds the mRNA codon is A...

  • QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated...

    QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated in the gene map below. The 5' UTR and 3' UTR segments are each 25 bp long. Exons 1 thru 4 are 100, 200, 300, 400 bp long, respectively. Each intron is 200 bp each. The locations of the relevant EcoRI sites within the ACEX locus are indicated, but the location of other restriction enzyme sites (like BamHI) are not shown." EcoRI probe EcoRI...

  • Below is a series of events involved in the mechanism of forming a retrotransposon. Place these...

    Below is a series of events involved in the mechanism of forming a retrotransposon. Place these steps in the correct order 1. the DNA copy is made double-stranded 2. DNA of the transposable element is transcribed 3. The DNA of the transposable element is integrated into a target DNA site 4. The RNA is reverse transcribed by reverse transcriptase, producing a complementary DNA 4,2,3,1 3,2,4,1 2,4,1,3 4,2,1,3 1,2,3,4 What is the function of the poly(A) tail on most mRNAs To...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT