
Both questions are related to each other, please make sure to answer both. I am struggling to get the concept.
Question 5
Answer: EcoRI restriction site is shown below:

EcoRI gives sticky ends. Single strand is shown for the fragments.
|
Number of fragments |
List of fragments in order of largest to smallest |
|
|
Sample 1 |
2 |
1.AATTCGCTAGTAACG 2.CAGTGATCTCG |
|
Sample 2 |
3 |
1. AATTCAGATGCCCA 2. AATTCCTGG 3. TCATG |
Question 2
Answer:
A linear DNA with three restriction sites for a restriction enzyme will produce 4 fragments after digestion (See figure below).

Both questions are related to each other, please make sure to answer both. I am struggling...
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The strand is cut at the position of the apostrophe. The 50 base pair sequence shown below contains one or more EcoRI sites. Find them and circle them. Then count the resulting size (in base pairs – bp) of the DNA fragments (pieces) left over after using EcoRI to cut this DNA sequence. Circle the EcoRI sites in the sequence below. 1- ggagaattcgctgtacgaggttaaccccgatgccATGGCATGAATTCGTG -50 List...
Module 2 homework Laurel Jacqmain- Assignment Score: 20% Resources Hint Check Answer Question 5 of 5 > A B C D E Restriction mapping of a linear piece of DNA reveals the EcoRI restriction sites. EcoRI site ! EcoRI site 2 2 kb. 4 kb 5 kb 11 kb 6 kb 5 kb 4 kb --3.5 kb 2 kb In each of the scenarios described, DNA is cut by EcoRI and the resulting fragments are separated by gel electrophoresis. The...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
5. If you are digesting a large linear fragment that is 300,000 bp in length. How many fragments would be produced if the DNA was digested by the following enzymes? Assume the fragment sizes are the average sizes calculated for a random DNA sequence. Use the information in the table from Question 3. Show your work. (A) Smal (B) Haelll (C) Noti Table 4.1 Recognition Sequences and Cutting Sites of Selected Restriction Endonucleases Enzyme Alul BamHI Bgli Clal ECORI Haelll...
i need from a to i please step by step
Question 2 (50 points) The template strand of a buman DNA and a plasmid are given below. The strands are read from left to right. Both DNAs are to be digested by the four base pair cutter restriction enzymes shown in the table Bacteria DNA: 3-ACAGACCATGGAGGCTCCCATGGTTAGCCTGAAGCTTCGA- 3'--CTTIGTGTOCCACCATGGCAGGTACCGAACCTCAACTTTCCTC.-5, Human DNA: Restriction Enzyme Name Ai Bi Ci Di Ei Sequence and type of eut GATC- 3 CTAG 5 T CGA-3 5- G...
A linear piece of DNA has the following restrictions sites:
You decided to set up an experiment where you added one of these
restriction enzymes to this DNA. After this DNA was digested with
that restriction enzyme, you separated the resulting fragment(s)
using agarose electrophoresis. After the gel was stained with
ethidium bromide, you observed the following gel (the DNA ladder is
your reference standard and is comprised of a series of DNA
fragments of known length).
a) Which restriction...
Can someone please help me answer these? Neat work is greatly
appreciated.
Explanation will also be appreciated (optional, if you have
time).
Thank you so much! I will give a big thumbs up :)
(1) You start with the pUC18 plasmid that is a -2.7 kb circular DNA molecule. The multiple cloning site (i.e., polylynker) has unique restriction sites in the following order: HindIII, BamHI, EcoRI. Recall that unique restriction site means that these sites are only found once on...
please help if you can
3. You cloned a 20 kb piece of DNA, which contains restriction sites as shown below. 281534 5 B 4 & 5 B = BamHl site, E = EcoRI site, H = Hindill site Numbers above the segments represent the sizes of the regions in kb. Draw and label (in the agarose gel below) the sizes of the fragments you would expect to see after complete digestion of this piece of DNA with the following...
Questions 9-12 deal with SSR loci in Sam's genome. Remember that SSRs (simple sequence repeats) are tandem (next to each other) repeats of short sequences (a few bp). Such tandem repeats are located at specific sites scattered throughout the genome. Individuals vary in the number of repeats at each site sites can have up to 100 repeats. Each locus with the same repeats is called an SSR ocus DNA was extracted from Sam's white blood cells and cut with a...
Hi I have a problem with number 5, it involves gel
analysis results. There are 2 parts, a,b,c. For A Im sure you need
to make a graph with distance in (cm) on the vertical axis and
log10 bp on the horitzontal. I need help figuring out where to
start and what to do. Please help!
The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...