You have a piece of DNA gene coding for GAGCTA. Which of the following is the...

Question

Question

science biology

Answer 1

Answer #1

1. The complementary sequence for the gene coding GAGCTA is CTCGAT.

Explanation: complementary strand is the DNA strand which have exactly opposite base pair and pairs up with the coding strand.

2. LSD is also known as lysergic acid diethylamine it is mainly produced from ergot fungus. Which causes hallucination.

3. In case of humans major gas exchange takes place in lungs.

Answer 2

Similar Homework Help Questions

A) An Operon is:? 1- A gene that affect another gene transcription. 2. A gene coding...

A) An Operon is:? 1- A gene that affect another gene transcription. 2. A gene coding for a metabolic pathway. 3. A protein that blockgene expression. 4. A set of genes under the control of one promoter. B )- In bacteria the Lac Operon genes code for proteins that break down.? 1- Arabinose 2- Lactose 3- Galactose 4- Glucose C )mRNA processing involves removal of .......? 1- Introns 2- The poly-A tail 3- The 5' cap 4- Exons D )...
The following is a partial DNA coding segment from Homo sapiens CD4 gene that encodes a...

The following is a partial DNA coding segment from Homo sapiens CD4 gene that encodes a membrane glycoprotein of T lymphocytes. 5’ACCGGGGAGTCCCTTTTAGGCACTTGCTTCTGG3’ 1. Produce the corresponding RNA fragment. 2. Produce the partial primary protein sequence (one letter codes for amino acids) using reading frame 3.
Which of the following contains a basement membrane? A) Nervous tissue B) Cardiac muscle C) DNA...

Which of the following contains a basement membrane? A) Nervous tissue B) Cardiac muscle C) DNA D) A and C E) None of the above

The following is a eukaryotic DNA sequence. The coding sequence of the gene is in bold...

The following is a eukaryotic DNA sequence. The coding sequence of the gene is in bold and italicized, and the promoter is enclosed in parenthesis. 5′ T G*A A G G A A T (TA T A A) T A C G A C C... A T G A T G T A C G C A T AAAC G T 3′ A mutation occurs in which a base (T) is inserted into the DNA sequence after the G, at...
7. Open reading frames A protein coding gene includes the following sequence on one of its...

7. Open reading frames A protein coding gene includes the following sequence on one of its two DNA strands. Note that this segment (within an exon) does NOT include either the start codon or the stop codon for this gene. However, because five of the six potential reading frames (3 on each DNA strand) in this region include stops, only the true reading frame remains "open" through this segment. Therefore, it is possible to unambiguously decode (translate) this segment of...
Which of the following is NOT a mechanism for gene regulation? a. Phase variation in DNA....

Which of the following is NOT a mechanism for gene regulation? a. Phase variation in DNA. b. Repressor binding to a promoter. c. Binding of a sRNA to a ribosome-binding site. d. None of the above.

QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated...

QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated in the gene map below. The 5' UTR and 3' UTR segments are each 25 bp long. Exons 1 thru 4 are 100, 200, 300, 400 bp long, respectively. Each intron is 200 bp each. The locations of the relevant EcoRI sites within the ACEX locus are indicated, but the location of other restriction enzyme sites (like BamHI) are not shown." EcoRI probe EcoRI...
Which of the following is a product that has resulted or improved because of recombinant DNA...

Which of the following is a product that has resulted or improved because of recombinant DNA technology? a. genetically engineered crops b. specialized microorganisms c. pharmaceuticals such as insulin and human growth hormone d. genetically engineered animals e. all of the above The disease Xeroderma pigmentosum results from DNA-repair defects. People with this disease are sensitive to UV light and have atypical skin pigmentation. Thus these people have higher incidences of what other disease? a. albinism b. skin cancer c. ...
22. Which of the following events is most likely to give rise to gene families? a....

22. Which of the following events is most likely to give rise to gene families? a. intragenic mutation b. DNA segment shuffling c. gene duplication d. horizontal transfer of DNA e. none of the above

Which of the following is NOT a DNA repair mechanism? a. base excision in which bulky...

Which of the following is NOT a DNA repair mechanism? a. base excision in which bulky lesions are removed and replaced with the original nucleotides b. direct repair of a modified base to the original structure c. repair of mismatched bases to the original pair of nucleotides on opposite strands d. replacement of nucleotides without the use of the complementary strand as a template e. all of the above