Why would you want to exclude low complexity regions from a BLAST search?
Why would you want to exclude low complexity regions from a BLAST search?
Homework Answers
The low complexity regions from a BLAST search are removed because cause artifactual hits. If we include low complexity regions it provides high scoring hits leads to false result.
Add Answer to:
Why would you want to exclude low complexity regions from a
BLAST search?
: Use P04637 as the query for PSI-BLAST search, select the nr database, exclude all primate...
: Use P04637 as the query for PSI-BLAST search, select the nr database, exclude all primate organism(s), and run many iterations until obtaining the hit of Electrophorus electricus. (revise with more limitation of information) Report for P04637.......: Use P04637 as the query for PSI-BLAST search, select the nr database, exclude all primate organism(s), and run many iterations until obtaining the hit of Electrophorus electricus. (revise with more limitation of information) Report for P04637 a. Locus name & gene name b....
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F 5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R 5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...
After a BLAST search you find a protein that gave you a bit score of 34....
After a BLAST search you find a protein that gave you a bit score of 34. Which arguments would you use to convince your peers that this protein is important to isolate and characterize further?
Which technique would you use if you wanted to < Identify all the regions of open...
Which technique would you use if you wanted to < Identify all the regions of open chromatin in a particular cell type? Perform a paternity test? Amplify a specific sequence of DNA? [Choose] [Choose] Promoter fusion DNAse-seq Scanning mutagenesis Western blot RNAseq DNA fingerprinting Northern blot Reporter Assay DNAse footprinting ChIP-PCR EMSA Southern blot DNAse protection assay PCR BLAST search Protein fusion ChIP-seq [Choose Compare the global level of RNA expression between two samples? Detect presence of a specific protein...
Why you need to have multiple indexing schemes if you want to search through a database...
Why you need to have multiple indexing schemes if you want to search through a database based on different keys?
Why does the OIG exclude individuals from health care? What impact would hiring an individual have...
Why does the OIG exclude individuals from health care? What impact would hiring an individual have on your long-term care facility?
To use the Basic Local Alignment Search Tool (BLAST) for the NCBI website, you will first...
To use the Basic Local Alignment Search Tool (BLAST) for the NCBI website, you will first need to have A. a nucleotide sequence B. mRNA converted to cDNA C. a polypeptide (amino acid) sequence D. any one of the above
Which regions would you recommend for direct production for market expansion? Which for exporting? Why?
Which regions would you recommend for direct production for market expansion? Which for exporting? Why?
7.4. If you want to synthesize ferrocene, you need cyclopentadiene. Search for a supplier. You wi...
7.4. If you want to synthesize ferrocene, you need cyclopentadiene. Search for a supplier. You will not find it. Why not? Explain using molecular orbitals and your vast knowledge of organic chemistry.
7.4. If you want to synthesize ferrocene, you need cyclopentadiene. Search for a supplier. You will not find it. Why not? Explain using molecular orbitals and your vast knowledge of organic chemistry.
how do you find minimum key in a binary search tree and find the time complexity...
how do you find minimum key in a binary search tree and find the time complexity of minimum algorithm worst case and giver an example of worst case in a binary search tree
Which technique would you use if you wanted to < Identify all the regions of open chromatin in a particular cell type? Perform a paternity test? Amplify a specific sequence of DNA? [Choose] [Choose] Promoter fusion DNAse-seq Scanning mutagenesis Western blot RNAseq DNA fingerprinting Northern blot Reporter Assay DNAse footprinting ChIP-PCR EMSA Southern blot DNAse protection assay PCR BLAST search Protein fusion ChIP-seq [Choose Compare the global level of RNA expression between two samples? Detect presence of a specific protein...
7.4. If you want to synthesize ferrocene, you need cyclopentadiene. Search for a supplier. You will not find it. Why not? Explain using molecular orbitals and your vast knowledge of organic chemistry.
7.4. If you want to synthesize ferrocene, you need cyclopentadiene. Search for a supplier. You will not find it. Why not? Explain using molecular orbitals and your vast knowledge of organic chemistry.
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago