To use the Basic Local Alignment Search Tool (BLAST) for the NCBI website, you will first...
- To use the Basic Local Alignment Search Tool (BLAST) for the NCBI website, you will first need to have A. a nucleotide sequence B. mRNA converted to cDNA C. a polypeptide (amino acid) sequence D. any one of the above
Homework Answers
Add Answer to:
To use the Basic Local Alignment Search Tool (BLAST) for the
NCBI website, you will first...
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F 5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R 5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...
Once a bacterial 16s rRNA gene has been amplified, it is possible to have the nucleotide...
Once a bacterial 16s rRNA gene has been amplified, it is possible to have the nucleotide sequence of the DNA determined. There are many different techniques for this. In lab, you isolated and amplified DNA from a known organism (Escherichia coli), but what if you had to identify an unknown organism? You would send the sample away for sequencing and then once you got the results you would “BLAST” the sequence. Using the Standard Nucleotide BLAST on NCBI and the...
Which method would be best to use to identify the active site of the porphyranase enzyme that is ...
Which method would be best to use to identify the active site of the porphyranase enzyme that is responsible for catabolizing porphyran? Choose one: A. KEGG (Kyoto Encyclopedia of Genes and Genomes) B. BLAST (Basic Local Alignment Search Tool) C. Multiple Sequence Alignment D. Motif Search
Genetics - Question 4 [15 marks] Sequence alignment is a critical tool for the analysis of genome data. Explain the pur...
Genetics - Question 4 [15 marks] Sequence alignment is a critical tool for the analysis of genome data. Explain the purpose of alignment scores in identifying the best alignments. [5 marks] What is the general concept upon which all protein scoring matrices are based? [3 marks] What is the difference between PAM and BLOSUM scoring matrices? [2 marks] You have a DNA sequence from a new microorganism. You search the NCBI nonredundant nucleic acid database using BLASTN. Surprisingly, you do...
x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1:...
x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homo sapiens, 2) Heterodoxus macropus, 3) E. coli. a. What is the common name of the species? b. How many nucleotide or protein sequence records do you find (show your search results in cropped windows)? Question 2: Use the name "plague thrips" to search the Nucleotide database. a. What is the scientific name of the plague thrips? b. How...
Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an...
Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an mRNA that can be translated. The gene organization is the order of the DNA segments that comprise the gene starting with the promoter, the first exon, the first intron, the second exon, and so on. The interspersed intrans can make gene identification difficult in eukaryotesparticularly in higher eukaryotes with many introns and alternative spliced mRNAs. Prediction of many genes and their organization has been...
x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1:...
x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homo sapiens, 2) Heterodoxus macropus, 3) E. coli. a. What is the common name of the species? b. How many nucleotide or protein sequence records do you find (show your search results in cropped windows)? Question 2: Use the name "plague thrips" to search the Nucleotide database. a. What is the scientific name of the plague thrips? b. How...
Just be need help with #4 er your nandwriting must be egible order to receive dealt...
Just be need help with #4
er your nandwriting must be egible order to receive dealt onee answers must be presented in a logical, and sequential manner. Do your explanation should be detailed enough for me to understand how things are rela not expect me to assume anything ing questions pertain to the polypeptide chain ill need to be very Descriptive Answer Number 1 worth 50 points. The follow drawn below. You will want to answer these questions on your...
1) Using the bacterial DNA sequence that the instructor gave you:
1) Using the bacterial DNA sequence that the instructor gave you:a. Identify and underline the promoter region and the start codon.b. Identify the coding and template strandc. Transcribe the coding sequenced. Translate the mRNA sequence8) Which of the following mutational changes would you predict to be the most deleterious to gene function? Explain your answers.a. Insertion of a single nucleotide near the end of the coding sequence.b. Removal of a single nucleotide near the beginning of the coding sequence.c. Deletion...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homo sapiens, 2) Heterodoxus macropus, 3) E. coli. a. What is the common name of the species? b. How many nucleotide or protein sequence records do you find (show your search results in cropped windows)? Question 2: Use the name "plague thrips" to search the Nucleotide database. a. What is the scientific name of the plague thrips? b. How...
x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homo sapiens, 2) Heterodoxus macropus, 3) E. coli. a. What is the common name of the species? b. How many nucleotide or protein sequence records do you find (show your search results in cropped windows)? Question 2: Use the name "plague thrips" to search the Nucleotide database. a. What is the scientific name of the plague thrips? b. How...
Just be need help with #4
er your nandwriting must be egible order to receive dealt onee answers must be presented in a logical, and sequential manner. Do your explanation should be detailed enough for me to understand how things are rela not expect me to assume anything ing questions pertain to the polypeptide chain ill need to be very Descriptive Answer Number 1 worth 50 points. The follow drawn below. You will want to answer these questions on your...
1) Using the bacterial DNA sequence that the instructor gave you:a. Identify and underline the promoter region and the start codon.b. Identify the coding and template strandc. Transcribe the coding sequenced. Translate the mRNA sequence8) Which of the following mutational changes would you predict to be the most deleterious to gene function? Explain your answers.a. Insertion of a single nucleotide near the end of the coding sequence.b. Removal of a single nucleotide near the beginning of the coding sequence.c. Deletion...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago