Which method would be best to use to identify the active site of the porphyranase enzyme that is responsible for catabolizing porphyran?
Choose one:
A. KEGG (Kyoto Encyclopedia of Genes and Genomes)
B. BLAST (Basic Local Alignment Search Tool)
C. Multiple Sequence Alignment
D. Motif Search
B. BLAST (Basic Local Alignment Search Tool)
BLAST can be used to identify the active site of the porphyranase enzyme that is responsible for catabolizing porphyran
Which method would be best to use to identify the active site of the porphyranase enzyme that is ...
To use the Basic Local Alignment Search Tool (BLAST) for the NCBI website, you will first need to have A. a nucleotide sequence B. mRNA converted to cDNA C. a polypeptide (amino acid) sequence D. any one of the above
Once a bacterial 16s rRNA gene has been amplified, it is possible to have the nucleotide sequence of the DNA determined. There are many different techniques for this. In lab, you isolated and amplified DNA from a known organism (Escherichia coli), but what if you had to identify an unknown organism? You would send the sample away for sequencing and then once you got the results you would “BLAST” the sequence. Using the Standard Nucleotide BLAST on NCBI and the...
Q1) Which of these best describes the multiple cloning site (MCS)? (1 mark) Select one: a. A sequence of DNA which can be used in agarose gel electrophoresis to determine the size of DNA molecules. b. A sequence of DNA which contains recognition sites for many restriction endonucleases. c. A sequence of DNA used to identify and/or select for transformed cells. d. A sequence of DNA which initiates replication and from which DNA replication proceeds. e. A sequence of DNA...
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F 5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R 5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...
Which technique would you use if you wanted to < Identify all the regions of open chromatin in a particular cell type? Perform a paternity test? Amplify a specific sequence of DNA? [Choose] [Choose] Promoter fusion DNAse-seq Scanning mutagenesis Western blot RNAseq DNA fingerprinting Northern blot Reporter Assay DNAse footprinting ChIP-PCR EMSA Southern blot DNAse protection assay PCR BLAST search Protein fusion ChIP-seq [Choose Compare the global level of RNA expression between two samples? Detect presence of a specific protein...
24. Explain the energetic benefits of making the enzyme active state rather than to the substrate conformation. Also explain how contribute to enzyme action. In other words, how do these weak intera enzyme and the transition state lower the activation energy?) of making the enzyme active site complementary to the transition nation. Also explain how multiple weak interactions words, how do these weak interactions between the 25. 1/F. The pk's of titratable groups of amino acids remain constant irrespective of...
Which of the following best describes an experimental design that would allow a researcher to use the CRISPR/Cas9 system to increase the expression of a target gene? Assume the researcher adds the appropriate guide RNA in each case. Select one: a. expression of a catalytically inactive Cas9 enzyme fused to a HAT b. expression of a catalytically active Cas9 enzyme fused to a HAT c. expression of a catalytically active Cas9 enzyme fused to an HDAC d. expression of a...
SHORT ANSWER. Write the word or phrase that best completes each statement or answers the question. 00 OA Figure 2.1 Using Figure 2.1, match the following: 1) Tertiary (protein) structure, 2) Monosaccharide 3) Nucleotide 4) Lipid 5) Functional protein 6) Polymer 7) Polysaccharide TRUE FALSE. Write T if the statement is true and F if the statement is false, 8) Final preparation for cell division is made during the cell life cycle subphase called G2. SHORT ANSWER. Write the word...
QUESTION 1 Although SARS-CoV-2 is currently a global health threat, how might we turn it into a tool for biotechnology? a. It could possibly be turned into a viral vector against lung cancers b. Its promoters might be used to express genes in lung cells c. Its surface proteins could be used for new epitope tags d. All of the above QUESTION 2 Which of the following are applications of molecular assembly described in this course? a. It can be...
Part I— Just Bad Luck? Brrrring! Brrrring! Jane checked the caller ID on her phone. “Sam! Great!” she thought. It was always nice to get a call from her older brother. But a little twinge of worry tugged at her. It was just a couple of weeks ago that he had mentioned making an appointment with his doctor about some abdominal pain he had been having. “Hi Sam! It’s great to hear from you,” Jane answered. “Hi Jane. Well I...