Please estimate the rate/speed of transcription and translation of mRNA.
Please estimate the rate/speed of transcription and translation of mRNA.
Homework Answers
The rate of transcription is 40-80 nucleotide per second.
The rate of translation is 20 amino acid per second. so 20X3 =60
nucleotide per second.
Add Answer to:
Please estimate the rate/speed of transcription and
translation of mRNA.
Please estimate the rate/speed of transcription and translation of mRNA. Please include calculations and explanations.
Please estimate the rate/speed of transcription and translation of mRNA. Please include calculations and explanations.
In bacteria, the process of translation affects the speed of transcription—efficient binding and progression of ribosomes...
In bacteria, the process of translation affects the speed of transcription—efficient binding and progression of ribosomes along the mRNA increases the speed of transcription, whereas the absence of ribosomes on the mRNA slows the movement of RNA polymerase along the DNA. Treatment of bacteria with an antibiotic that inhibits translation slows the progression of RNA polymerase along the DNA. Likewise, if ribosomal proteins are mutated in a way that slows or inhibits translation, the process of transcription also slows. Furthermore,...
Question 23 of mRNA occurs in/on the O Translation, ribosome Translation, endoplasmic reticulum O Transcription, ribosome...
Question 23 of mRNA occurs in/on the O Translation, ribosome Translation, endoplasmic reticulum O Transcription, ribosome O Transcription, endoplasmic reticulum - Previous
Determine if the following words describe transcription, translation, or both transcription and translation. Nucleotide Ribosome Amino...
Determine if the following words describe transcription, translation, or both transcription and translation. Nucleotide Ribosome Amino acid mRNA Nucleus DNA
Part A What is the process of synthesizing protelins from MRNA sequences? translation replication transcription transformation...
Part A What is the process of synthesizing protelins from MRNA sequences? translation replication transcription transformation transduction Request Answer Submit
Assuming transcription and translation are taking place simultaneously, is the cell below a eukaryotic or prokaryotic...
Assuming
transcription and translation are taking place
simultaneously, is the cell below a eukaryotic or
prokaryotic cell? Please explain your answer.
RNA polymerase DNA Ribosome Transcription Polypeptide- Translation MRNA
List the steps involved in the transcription and translation of DNA into mRNA and tRNA in order? DNA replicated to RNA t...
List the steps involved in the transcription and translation of DNA into mRNA and tRNA in order? DNA replicated to RNA tRNA translates mRNA and adds amino acids to the growing peptide chain making a protein mRNA leaves nucleus Introns are excised from hnRNA Addition of 5' cap and poly-A tail to mRNA
Summarize the relationship between genes and proteins . Explain the purpose of transcription and translation. Describe...
Summarize the relationship between genes and proteins . Explain the purpose of transcription and translation. Describe the steps of transcription I State the enzyme or structures that perform transcription and translation. Contrast prokaryotic and eukaryotic mRNA . Describe the process of translation .Describe the role of tRNA in translation . Explain the role of codons and anticodons in translation. Explain the significance of stop codons and start codons. Given a double stranded DNA gene sequence, be able to produce the...
OnuA sran A T TA CGATCTG CA CAAGACTT C Transcription mRNA strand Amino Acids ORNA Strand C GTACGA...
onuA sran A T TA CGATCTG CA CAAGACTT C Transcription mRNA strand Amino Acids ORNA Strand C GTACGAATTGCCAATTA CT Transcription mRNA strand: Amino Acids TA C G G A A T C GATG CGCGCACT ONA Strand RNA strand Translation 59. ad TA CCCATGGGGAAATATC ONA Strand mRNA strand Amino Acds randG CGCTA CA A TTGGATCG Translation Amino Acids ONA Strand GACUAGCUGGGGGUAUUACUUUUA G Transcription Translation DNA Strand ACCGCTCCGCCGTCGACAATACCACT ranscription mRNA strand Transcription A CCACCCCCGUAUGGCUGGGAAUAUC Anticodor
onuA sran A T TA CGATCTG CA...
1. Which of the following statements concerning transcription of bacterial mRNA is not true? Bacterial mRNA...
1. Which of the following statements concerning transcription of bacterial mRNA is not true? Bacterial mRNA must have intron material removed before it can be used in the process of protein translation.* Energy necessary for transcription is provided by the breaking of phosphate bonds carried by ribonucleotide triphosphates (rNTPs). A sigma factor recognizes the promoter site sequences on the DNA strand during transcription. A guanine-rich sequence on the template DNA molecule causes the growing RNA strand to loop and detach.
Question 23 of mRNA occurs in/on the O Translation, ribosome Translation, endoplasmic reticulum O Transcription, ribosome O Transcription, endoplasmic reticulum - Previous
Determine if the following words describe transcription, translation, or both transcription and translation. Nucleotide Ribosome Amino acid mRNA Nucleus DNA
Part A What is the process of synthesizing protelins from MRNA sequences? translation replication transcription transformation transduction Request Answer Submit
Assuming
transcription and translation are taking place
simultaneously, is the cell below a eukaryotic or
prokaryotic cell? Please explain your answer.
RNA polymerase DNA Ribosome Transcription Polypeptide- Translation MRNA
Summarize the relationship between genes and proteins . Explain the purpose of transcription and translation. Describe the steps of transcription I State the enzyme or structures that perform transcription and translation. Contrast prokaryotic and eukaryotic mRNA . Describe the process of translation .Describe the role of tRNA in translation . Explain the role of codons and anticodons in translation. Explain the significance of stop codons and start codons. Given a double stranded DNA gene sequence, be able to produce the...
onuA sran A T TA CGATCTG CA CAAGACTT C Transcription mRNA strand Amino Acids ORNA Strand C GTACGAATTGCCAATTA CT Transcription mRNA strand: Amino Acids TA C G G A A T C GATG CGCGCACT ONA Strand RNA strand Translation 59. ad TA CCCATGGGGAAATATC ONA Strand mRNA strand Amino Acds randG CGCTA CA A TTGGATCG Translation Amino Acids ONA Strand GACUAGCUGGGGGUAUUACUUUUA G Transcription Translation DNA Strand ACCGCTCCGCCGTCGACAATACCACT ranscription mRNA strand Transcription A CCACCCCCGUAUGGCUGGGAAUAUC Anticodor
onuA sran A T TA CGATCTG CA...
1. Which of the following statements concerning transcription of bacterial mRNA is not true? Bacterial mRNA must have intron material removed before it can be used in the process of protein translation.* Energy necessary for transcription is provided by the breaking of phosphate bonds carried by ribonucleotide triphosphates (rNTPs). A sigma factor recognizes the promoter site sequences on the DNA strand during transcription. A guanine-rich sequence on the template DNA molecule causes the growing RNA strand to loop and detach.
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago