Homework Answers
7) A) The process is named as transcription.
B) RNA polymerase enzyme is responsible for this process.
C) Transcription occurs in the nucleus.
D) Transcription begins in promoter region of the DNA.
E) RNA splicing is a process in which a newly made precursor messenger RNA (pre-mRNA) transcript can be transformed into a mature messenger RNA (mRNA).
8) The sequence is AUGUACCGAUGA
9) There is more than one codon. the most amino acids are encoded by more than one triplet combination. So the genetic code is redundant. But each codon specifies only one amino acid. Thats why it is unambiguous.
10) A single amino acid is specified by a sequence of three nucleotides in the mRNA. It consists of 64 codon due to its triplet nature. There are 64 codons and code 20 amino acids.
Add Answer to:
every question
w Of Hors in we C. What does you D. Namewe entrymes responsible for...
The process of making RNA using DNA as a template is called ___. The process of...
The process of making RNA using DNA as a template is called ___. The process of using the codes in RNA to make protein is called ___. Complete the following table with information on the three types of RNA polymerases and role of specific type of RNA in protein synthesis: In prokaryotes, the two stages of protein synthesis are: ___ and ___. In eukaryotes, the three stages of protein synthesis are ___, ___ and ___. During transcription, a ___ ___...
QUESTION 15 RNA modification involves: O A. splicing B. 3' poly A tailing O C. 5'...
QUESTION 15 RNA modification involves: O A. splicing B. 3' poly A tailing O C. 5' capping O D. all of the above QUESTION 16 What is the contribution or purpose of 5' capping? o It helps the mRNA exit the nucleus. o promotes efficient splicing. o It helps in the initiation of translation o all of the above QUESTION 17 What is translation? O process of making RNA O process of making DNA O process of making protein O...
(b)Where in the cell does this process occur? Q3 to create a protein. is the process...
(b)Where in the cell does this process occur? Q3 to create a protein. is the process in which mRNA is used as a template (b)Where in the cell does this process occur? Q4 carries amino acids to the ribosome for protein synthesis. Q5 Give the complementary DNA sequence to AGGCTATTCATT. Q6 Give the complementary RNA sequence to AGGCTATTCATT. Q7 Use Table 9.4 to give the amino acid sequence that results from the above RNA. Q8 What are two differences betweeen...
1. Which of the following statements about the flow of genetic information is true? a. Proteins...
1. Which of the following statements about the flow of genetic information is true? a. Proteins encode information that is used to produce other proteins of the same amino acid sequence. b. RNA encodes information that is translated into DNA, and DNA encodes information that is translated into proteins. c. Proteins encode information that can be translated into RNA, and RNA encodes information that can be transcribed into DNA. d. DNA encodes information that is translated into RNA, and RNA...
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c....
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...
Paragraph Lipod 64. Styles Which of the following is a ribonucleoprotein? A. Signal Recognition Particle B....
Paragraph Lipod 64. Styles Which of the following is a ribonucleoprotein? A. Signal Recognition Particle B. ribosome C. telomerase D. SnRNP E. all of the above 65._ What is the term for the base pair position in the diagram below? A. ambiguous B. jiggle C. redundant D. triplet E. wobble mini TRNA mRNA 5- 12 Name this position 1711 words Clipboard Font Paragraph amino acid binding site intrastrand hydrogen bonds "charged" tRNA binds to binds to 50S charging enzyme ribosomal...
1 pts DI Question 6 What region of this molecule shown would bind to mRNA during...
1 pts DI Question 6 What region of this molecule shown would bind to mRNA during translation? 3' A-OH 5' A Cacceptor stem G C G- U TuC loop D-loop C U GACAC m'A GGAGAGm m' G C-G A-U variable loop Anticodon loop Cm U A Gm A A The 5' end The anticodon loop The 3 end The variable loop The acceptor stem D Question 7 1 pts What is synthesized during transcription? O a strand of tRNA O...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose...
c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...
2 points Which of the statements below is false? * O The genetic code is universal....
2 points Which of the statements below is false? * O The genetic code is universal. Degenerate codons specify the same amino acids. The genetic code is overlapping. O The genetic code is triplet. 2 points How many hydrogen bonds does cytosine form with guanine? * 2 3 O 4 2 points The amino acid sequence of a polypeptide chain comprises the structure of the protein. * primary secondary tertiary O quaternary 2 points One gene can have multiple effects...
The process of making RNA using DNA as a template is called ___. The process of using the codes in RNA to make protein is called ___. Complete the following table with information on the three types of RNA polymerases and role of specific type of RNA in protein synthesis: In prokaryotes, the two stages of protein synthesis are: ___ and ___. In eukaryotes, the three stages of protein synthesis are ___, ___ and ___. During transcription, a ___ ___...
QUESTION 15 RNA modification involves: O A. splicing B. 3' poly A tailing O C. 5' capping O D. all of the above QUESTION 16 What is the contribution or purpose of 5' capping? o It helps the mRNA exit the nucleus. o promotes efficient splicing. o It helps in the initiation of translation o all of the above QUESTION 17 What is translation? O process of making RNA O process of making DNA O process of making protein O...
(b)Where in the cell does this process occur? Q3 to create a protein. is the process in which mRNA is used as a template (b)Where in the cell does this process occur? Q4 carries amino acids to the ribosome for protein synthesis. Q5 Give the complementary DNA sequence to AGGCTATTCATT. Q6 Give the complementary RNA sequence to AGGCTATTCATT. Q7 Use Table 9.4 to give the amino acid sequence that results from the above RNA. Q8 What are two differences betweeen...
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...
Paragraph Lipod 64. Styles Which of the following is a ribonucleoprotein? A. Signal Recognition Particle B. ribosome C. telomerase D. SnRNP E. all of the above 65._ What is the term for the base pair position in the diagram below? A. ambiguous B. jiggle C. redundant D. triplet E. wobble mini TRNA mRNA 5- 12 Name this position 1711 words Clipboard Font Paragraph amino acid binding site intrastrand hydrogen bonds "charged" tRNA binds to binds to 50S charging enzyme ribosomal...
1 pts DI Question 6 What region of this molecule shown would bind to mRNA during translation? 3' A-OH 5' A Cacceptor stem G C G- U TuC loop D-loop C U GACAC m'A GGAGAGm m' G C-G A-U variable loop Anticodon loop Cm U A Gm A A The 5' end The anticodon loop The 3 end The variable loop The acceptor stem D Question 7 1 pts What is synthesized during transcription? O a strand of tRNA O...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...
2 points Which of the statements below is false? * O The genetic code is universal. Degenerate codons specify the same amino acids. The genetic code is overlapping. O The genetic code is triplet. 2 points How many hydrogen bonds does cytosine form with guanine? * 2 3 O 4 2 points The amino acid sequence of a polypeptide chain comprises the structure of the protein. * primary secondary tertiary O quaternary 2 points One gene can have multiple effects...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago