What would happen if an incoming nucleotide lacked a 3' hydroxl group?? Please Explain!
What would happen if an incoming nucleotide lacked a 3' hydroxl group?? Please Explain!
Homework Answers
Add Answer to:
What would happen if an incoming nucleotide lacked a 3' hydroxl
group?? Please Explain!
Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence...
Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence got changed to ACA (original = ACG) 4. codon #2 got changed to ACC 5. codon #2 got changed to ACT o Explain the consequences of each mutation in #3-5 (how would it change the outcome?) o Use this sequence of nucleotides (DNA): 3'TACACGGCCCTTGGAAAACACACT5 1. Transcribe the DNA 2. Translate the DNA using genetic code dictionary
24) What would you expect to happen in the following situation? If the incoming light ray...
24) What would you expect to happen in the following situation? If the incoming light ray goes from greater to lesser and then from lesser to greater than. Use the pic below as a guide. normal incident reflected refracted emergent normal a) If you go from an indices that is less to an indices that is greater ... what would happen to the angle of refraction? > Move towards the normal Stay the same → Move away from the normal
In transcription, the 3'-hydroxyl group of the growing RNA strand: attacks the alpha-phosphorous group of the...
In transcription, the 3'-hydroxyl group of the growing RNA strand: attacks the alpha-phosphorous group of the incoming nucleotide. binds to a copper ion in the active site. binds to the 5' ribose. attacks the 5' hydrogen of the incoming nucleotide. All of the above None of the above.
24) What would you expect to happen in the following situation? If the incoming light ray...
24) What would you expect to happen in the following situation? If the incoming light ray goes from less to greater and then from greater to less than. Use the pic below as a guide. incident normal reflected ray refracted ray emergent normal a) If you go from an indices that is less to an indices that is greater ... what would happen to the angle of refraction? ► Move towards the normal Stay the same Move away from the...
24) What would you expect to happen in the following situation? If the incoming light ray...
24) What would you expect to happen in the following situation? If the incoming light ray goes from greater to lesser and then from lesser to greater than. Use the pic below as a guide. incident normal reflected ray refracted emergent normal a) If you go from an indices that is less to an indices that is greater ... what would happen to the angle of refraction? Move towards the normal > Stay the same → Move away from the...
Could please explain what would happen in these scenarios 1. If the base sequences of the...
Could please explain what would happen in these scenarios 1. If the base sequences of the guide RNA and the target DNA do NOT match If the base sequences of the guide RNA and the target DNA do match
What would you expect to happen if an unknown solution that may contain ions from Group...
What would you expect to happen if an unknown solution that may contain ions from Group I through V were treated with Na2CO3 under basic conditions? Explain in terms of the solubility rules.
What would happen in the synthesis of sulfanilamide if the amino group were not protected as an a...
What would happen in the synthesis of sulfanilamide if the amino group were not protected as an amide in the chlorosulfonation step? If the Amino group were NOT protected, it would do a ____ substitution on chlorosulfonic acid. Later in the sequence, this group ____ be removed without cleaving the other sulfonamide group. electrophilic; could not nucleophilic; could not nucleophilic; could electrophilic; could
3. Briefly describe the importance of accurate splicing. What happens if too much RNA is removed during splicing? What happens if not enough RNA is removed during splicing? What would happen if a...
3. Briefly describe the importance of accurate splicing. What happens if too much RNA is removed during splicing? What happens if not enough RNA is removed during splicing? What would happen if a splicing event results in the deletion of a single nucleotide from the beginning of an exon? (4 points)
3. Briefly describe the importance of accurate splicing. What happens if too much RNA is removed during splicing? What happens if not enough RNA is removed during splicing? What...
Explain what would happen to the velocity of the cart as the incline angle of the...
Explain what would happen to the velocity of the cart as the incline angle of the track increases.
Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence got changed to ACA (original = ACG) 4. codon #2 got changed to ACC 5. codon #2 got changed to ACT o Explain the consequences of each mutation in #3-5 (how would it change the outcome?) o Use this sequence of nucleotides (DNA): 3'TACACGGCCCTTGGAAAACACACT5 1. Transcribe the DNA 2. Translate the DNA using genetic code dictionary
24) What would you expect to happen in the following situation? If the incoming light ray goes from greater to lesser and then from lesser to greater than. Use the pic below as a guide. normal incident reflected refracted emergent normal a) If you go from an indices that is less to an indices that is greater ... what would happen to the angle of refraction? > Move towards the normal Stay the same → Move away from the normal
In transcription, the 3'-hydroxyl group of the growing RNA strand: attacks the alpha-phosphorous group of the incoming nucleotide. binds to a copper ion in the active site. binds to the 5' ribose. attacks the 5' hydrogen of the incoming nucleotide. All of the above None of the above.
24) What would you expect to happen in the following situation? If the incoming light ray goes from less to greater and then from greater to less than. Use the pic below as a guide. incident normal reflected ray refracted ray emergent normal a) If you go from an indices that is less to an indices that is greater ... what would happen to the angle of refraction? ► Move towards the normal Stay the same Move away from the...
24) What would you expect to happen in the following situation? If the incoming light ray goes from greater to lesser and then from lesser to greater than. Use the pic below as a guide. incident normal reflected ray refracted emergent normal a) If you go from an indices that is less to an indices that is greater ... what would happen to the angle of refraction? Move towards the normal > Stay the same → Move away from the...
3. Briefly describe the importance of accurate splicing. What happens if too much RNA is removed during splicing? What happens if not enough RNA is removed during splicing? What would happen if a splicing event results in the deletion of a single nucleotide from the beginning of an exon? (4 points)
3. Briefly describe the importance of accurate splicing. What happens if too much RNA is removed during splicing? What happens if not enough RNA is removed during splicing? What...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago