Question

1) Imagine that you are interested in studying the enzyme dihydrofolate reductase (DHFR) from Mycobacterium tuberculosis (thi---- UUUUUUUUUUUCCOUNCI GGGTGATCGGAGGCGGACAAGTCTATGCGCTGGCGCTGCCGTACGCGACCAGATGTGAGGTTACCGAGGT CGACATCGGCCTGCCGCGCGAAGCCGGTGAClearly state the nucleotide sequence (noting the 5 to 3 ends) of each of your two PCR primers, and the predicted melting t

0 0
Add a comment Improve this question Transcribed image text
Answer #1

a. The recognizing sequence is the restriction site  where the restriction enzyme recognize the site and cleave the restriction fragments. the sequence may vary based upon the enzyme.

Ndel sequence is: 5'CATATG3'

3'GTATAC5'

BamH1 sequence is: 5'GGATCC

3'CCTAGG

b.) PCR is a polymerize chain reaction where it needs a pair of primers to amplify the given template and resulting in the formation of product.

Forward primer: GCCTCCGGTAAGTCCGGCCGCT

Reverse primer :CGCGGCAGCGCGCGAGTGGCCGA

melting temperature can be estimated by formula: Tm = 4(G+C)/2(A+T)

Add a comment
Know the answer?
Add Answer to:
1) Imagine that you are interested in studying the enzyme dihydrofolate reductase (DHFR) from Mycobacterium tuberculosis...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using...

    QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using blue/white colony selection, why could you assume that white colonies have modified plasmids? a. A blue colony means the LacZ reading-frame was disrupted b. A blue colony means your gene has mutations c. A white colony means the LacZ reading-frame is intact d. A white colony means the LacZ reading-frame was disrupted    QUESTION 2: You are performing a PCR using primers with a sequence perfectly...

  • Below is a set of experiments for cloning the human growth hormone (HGH) gene and then...

    Below is a set of experiments for cloning the human growth hormone (HGH) gene and then expressing the HGH protein in E. coli starting from human pituitary glands and a tube of plasmid vector DNA. The plasmid expression vector contains the arabinose inducible expression system. Specify the correct order for carrying out these experiments, using the letter codes in front of each procedure. Use all of the steps in your answer, except for one step that should NOT be included....

  • These are previous exam questions I am just preparing for the final exam by studying the...

    These are previous exam questions I am just preparing for the final exam by studying the previous questions! please help me out! A1. The following is the DNA sequence of a hypothetical gene for the SMALL protein. It is called the SMALL gene. 1 atgggattac actgtcacga ccaaatagcc ttcattgtat 41 caaaaggatc aatcgagtta tag Imagine you are doing a research project in a laboratory and your supervisor asks you to clone the SMALL gene into the pBR322 plasmid (shown below) You must...

  • In your previous prac session you digested your POTC-A plasmid DNA with 3 enzyme mixes (AB...

    In your previous prac session you digested your POTC-A plasmid DNA with 3 enzyme mixes (AB and C). One mix contained the restriction endonuclease Kpnl alone, another contained both del and Not and another contained Sphi and Nhe, but you don't know which was which yet. The sites where these enzymes cut POTC-A are indicated on the plasmid map at the top of the page. Calculate the sizes of the DNA fragments that you would expect to see on your...

  • 1) You have two human liver cells (A and B) and you hypothesize that the insulin...

    1) You have two human liver cells (A and B) and you hypothesize that the insulin receptor gene in Cell A has a mutation in exon 1 and Cell B contains the wild type sequence.  You extract genomic DNA from each of the cells.  Of the following, what would be the most efficient (quick, precise and relatively cheap) way to test your hypothesis. a. Isolate protein from both cells, purify the insulin receptor, and determine the amino acid content. b. Sequence the...

  • Draw (or arrange) only the items you need from the Lab Materials Page (picture below) in...

    Draw (or arrange) only the items you need from the Lab Materials Page (picture below) in the order you would use them to make AND screen a gene library. You will ‘draw’ the steps that use the Lab Materials in the correct order to create and screen a gene library which has the assigned gene clone. You will need to add some connecting words and phrases to make all the steps for making your library clear. The genomic gene clone...

  • Identify two restriction endonucleases that could be used to make sticky ends near the 5’ end of this DNA sequence (uppe...

    Identify two restriction endonucleases that could be used to make sticky ends near the 5’ end of this DNA sequence (upper strand) so that it could be incorporated into a new plasmid. You have a short list of them in Table 9-2, and the specific, short sequences of bases that other enzymes cut at are easily obtained from web resources. You must cut as near to the 5' end as possible. Indicate the specific sequences of bases for each endonuclease...

  • 1. Describe the functions of the following reagents in extraction of DNA from corn meal: proteina...

    1. Describe the functions of the following reagents in extraction of DNA from corn meal: proteinase K; guanidine HCI; SDS 2. Why is the ratio of the OD at 260 and 280 nm used to estimate DNA purity? 3. In one paragraph, summarize basic principles of PCR technique in your own words. List all the reagents you will need to perform a PCR experiment. Does this method tell you what genetic modifications were made? If yes, describe how you can...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT