Answer:
Please Rate My Answer...... Thank......u...
6. The two oligonucleotides below are allowed to anneal and a set of sequencing reactions are...
Question 2
Classical DNA sequencing is a powerful technique. Consider a situation where you first sequence a normal strand of DNA, then sequence a mutated strand. When analysing the results of sequencing reactions, run on a gel, would you be able to distinguish each of the following mutation types, compared to unmutated sequence, using classic "Sanger" sequencing? A silent mutation An insertion of 6 nucleotides A sense mutation Which of the following factors directly breaks phosphodiester bonds? Select all that...
3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing method. Below is the DNA sequence from a region of the vector. 5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’ 3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’ To which DNA strand does the primer bind, the top or bottom one? Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band)...
9. (8 points) Use the figure below to answer the following questions about Sanger Dideoxy sequencing. GATC 11.1 This figure represents a portion of a polyacrylamide gel used to separate DNA fragments produced from a Sanger dideoxy DNA sequencing reaction. Write the sequence of the boxed portion of the newly synthesized (nascent) strand (in the 5' to 3' direction). Label the 5' and 3' ends of the DNA sequence. 11 il Write the DNA sequence of the complementary template strand...
Pleaae answer this with explanation asap.I would really apprecuate
it .
6. (4 points) Dideoxy sequencing of a fragment of DNA produces the gel pattern shown below, with the and+ to the left of the gel referring to the negative and positive electrodes of the gel, respectively. C T A G Which of the following statements about the gel products and the sequence of the DNA template are correct? The sequence of the template DNA is 5'-GACTCGACTGTACGTGC-3', te letter above...
If you wish to sequence a long strand of DNA in one round of reactions, you should: O A. Decrease the ddNTP/dNTP ratio O B. Increase the ddNTP/dNTP ratio O C. Use a shorter DNA primer O D. Add twice as much primer Based on this figure, the most likely error is: O A. The scientist forgot to add dNTPs to one of the reaction tubes. O O B. <label for="q7_4" id="lq7_4">The scientist did not denature the DNA strands</label> O...
4. (1.5 pts)You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below. 5°-АсттсслтАTстсТАЛААТАССАТCGATСтстсссссстАGстAСCТААССАGAGACCСТАССG-3. 3-тслАсстатАсAGATTTTATсстасстаGлCAссссССATCCATCGAтTСстстстасGAТСCС-5. Markers part (a) part (b) part ck Right primer should anneal to this region Left primer should 87 nts anneal to this region 80 nts 70 nts 60 nts 50 nts 40 nts 27 nts Draw into the following gel lanes what size(s) of PCR products you would get if you...
central dogma question
The nucleotide sequence below is from an individual. Only one strand of the chromosome is shown. Write the complementary strand of the DNA below. Watch your polarity! Below are two sequences, A and B. Both of these sequences are from the same gene from two different individuals. Differences in their sequence are highlighted red. What do these two sequences (A and B) represent? Now predict what a DNA gel of digested DNA from individual A and B...
QUESTION 31 The gel below shows the result of sequencing a piece of DNA (the "template"). Each lane shows the fragments of the new strand (the "daughter" strand) that are produced when a given ddNTP is added to the PCR reaction. Based on these results, what is the sequence of the template (original) DNA strand? Please write (type) it out, making sure you indicate the 5' and 3" ends ddATP ddTTP ddCTP ddGTP well well well well save Click Save...
looking for answers only questions #4 And #5 and #6
1 1 - + O Fit to page Page View A Read aloud Add notes 6 8 % 1. Why do individuals have two copies of each STR region? (Hint: Humans have maternal and paternal chromosomes.) Below is a DNA profile of three individuals using two different STRs: AGGCT and CAATG ) The DNA profile below shows the band pallerns of three individuals that resulted from gel electrophoresis separating the...
6) Many scientists doubted that shotgun sequencing would work, even with the smallest genomes, because: a. There would not be overlaps between the different mini-sequences. b. Computers would be unable to handle the huge amount of data generated by a shotgun sequencing project. c. Small prokaryotic genomes contain large amounts of repetitive DNA. d. No method existed for breaking genomic DNA into random fragments. 7) In a PCR-RFLP assay, enzyme digestion revealed three bands (152+187+462bp) in AA animals, four bands...