Question
help asap! easy! bio
Predict the number and sizes of bands when the sample DNA is cut by the enzyme. The line is the DNA; it is linear. The Xs ar
0 0
Add a comment Improve this question Transcribed image text
Answer #1

There will be 5 bands.

1 to 340 = 340 base pairs

340 to 800 = 460 base pairs

800 to 2350 = 1550 base pairs

2350 to 2550 = 200 base pairs

2550 to 3200 = 650 base pairs

Please rate high.

Add a comment
Know the answer?
Add Answer to:
help asap! easy! bio Predict the number and sizes of bands when the sample DNA is...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • . Using the figure of the gel below, draw in the DNA bands in the left...

    . Using the figure of the gel below, draw in the DNA bands in the left lane that would appear from the DNA of the person described in the question above. The right lane contains a molecular weight standard. the questions are When circular DNA is sequenced, the nucleotide base pairs are numbered starting from an fixed position on the DNA, all the way around, usually in a clockwise manner.   a DNA molecule that is 3133 base pairs long is...

  • A restriction map lists the locations of DNA sequences that are cut by a particular restriction...

    A restriction map lists the locations of DNA sequences that are cut by a particular restriction enzyme for a piece of DNA, such as a chromosome or a plasmid. Restriction maps are important when generating a construct for experimental use. Digesting the DNA sequence with the restriction enzymes will result in fragmented DNA of predictable sizes, based on the restriction map, that allow a researcher to analyze if his or her construct was generated correctly when visualized using gel electrophoresis....

  • can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel be...

    can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...

  • Hi I have a problem with number 5, it involves gel analysis results. There are 2 parts, a,b,c. For A Im sure you need to make a graph with distance in (cm) on the vertical axis and log10 bp on the hor...

    Hi I have a problem with number 5, it involves gel analysis results. There are 2 parts, a,b,c. For A Im sure you need to make a graph with distance in (cm) on the vertical axis and log10 bp on the horitzontal. I need help figuring out where to start and what to do. Please help! The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...

  • The figure below shows a restriction map of a segment of a DNA molecule. Eco refers...

    The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...

  • You are given a circular DNA molecule to analyze that is 3,000bp (3 Kb) long. You...

    You are given a circular DNA molecule to analyze that is 3,000bp (3 Kb) long. You proceed to treat the DNA molecule with different cutting enzymes and then you run the individual reactions on a gel. The following gel is produced with each column representing a different reaction (lane). In lane 1 a molecule weight ladder is run. In lane 2, the circular DNA is NOT treated with any enzyme. In lane 3 the DNA is treated with an enzyme...

  • Hi can someone help me understand part C and why the drawn in red lines are...

    Hi can someone help me understand part C and why the drawn in red lines are where they are. Basically from the bp given how can I go back to cm so I can drawn them into the picture provided? Do not need help with A or B. The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes...

  • In your previous prac session you digested your POTC-A plasmid DNA with 3 enzyme mixes (AB...

    In your previous prac session you digested your POTC-A plasmid DNA with 3 enzyme mixes (AB and C). One mix contained the restriction endonuclease Kpnl alone, another contained both del and Not and another contained Sphi and Nhe, but you don't know which was which yet. The sites where these enzymes cut POTC-A are indicated on the plasmid map at the top of the page. Calculate the sizes of the DNA fragments that you would expect to see on your...

  • One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...

    One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...

  • Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel...

    Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel electrophoresis, the DNA fragments can be separated on a gel, based on their lengths. In order to see the fragments, a stain is typically added to the gel. The size of each fragment can be determined by comparing each one to a DNA molecular weight marker of known size. Below is a map of pBR22 plasmid. The position and base pair number of the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT