Question
Thank you!!
Question 50 1 pts The first start codon you see in the same sequence) is the one the ribosome uses to start translation Which
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Question 50 1 pts The first start codon you see in the same sequence) is the one the ribosome uses to start translation. WhicAnswer is A. third.

Add a comment
Know the answer?
Add Answer to:
Thank you!! Question 50 1 pts The first start codon you see in the same sequence)...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 4. In the following sequence, we see a stop codon (in bold) followed by a start...

    4. In the following sequence, we see a stop codon (in bold) followed by a start codon (Underlined) Assuming the cell is normal and is capable of carrying out translation, would this particular RNA fragment be translated (explain why or why not) (6 pts)? 5'-AUCGAUAACUAUGCCCG..G ACGGAGCUAGCCCAAAAAAAAAAA-3 Concerning the RNA strand shown above, name three different proteins you might find attached to this RNA fragment and show where each might be attached (4 pts)

  • This Question: 1pc Write the first six terms of the arithmetic sequence with the given first...

    This Question: 1pc Write the first six terms of the arithmetic sequence with the given first term, ay, and common difference, d a = -3, d=8 The first term of the sequence is a, = (Simplify your answer.) The second term of the sequence is az = (Simplify your answer.) The third term of the sequence is ag = 0 (Simplify your answer.) The fourth term of the sequence is at - (Simplify your answer.) The fifth term of the...

  • O c) >0 kcal/mol Question 37 1 pts Assuming that cytosine is in the first position of an anticodo...

    O c) >0 kcal/mol Question 37 1 pts Assuming that cytosine is in the first position of an anticodon, which of the following nucleoside will be in the third position of a codon? 0 a) Adenine O b) Guanine O c) Uracil O d) Cytosine Question 38 1 pts Which of the following statements about an E. coli ribosome is correct? O c) >0 kcal/mol Question 37 1 pts Assuming that cytosine is in the first position of an anticodon,...

  • C++: Translating mRNA sequence help Homework Description Codon 1 You are working in a bioinformatics lab...

    C++: Translating mRNA sequence help Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...

  • 24. Now consider that same sequence as above except that the base marked with an asterisk (") is changed from a G to an A (see below), How does that change alter the outcome -CAUCGCUCAUGAACGCA...

    24. Now consider that same sequence as above except that the base marked with an asterisk (") is changed from a G to an A (see below), How does that change alter the outcome -CAUCGCUCAUGAACGCAG UUAGUCAGUAGUCCUGGACC- 3 a) That change does not alter the translation product. That change alters the translation product. That is an example of a missense mutation b) The change alters one of the translation products, This is an example of a missense mutation d) c) That...

  • C++ Programming help, please include comments to help me understand the code. Thank you for helping....

    C++ Programming help, please include comments to help me understand the code. Thank you for helping. Task C: Substitution and Hamming Distance For this task, we will explore mutations that occur by substitution. Your task is to write a program called hamming.cpp that calculates the Hamming distance between two strings. Given two strings of equal length, the Hamming distance is the number of positions at which the two strings differ. e. g.: Hamming("aactgc", "atcaga") would output 3. Notice that certain...

  • Question 10 0.25 pts Which of the following is true of snRNPs? They bind to the...

    Question 10 0.25 pts Which of the following is true of snRNPs? They bind to the TATA box of the promoter region of a gene. They bind to splice sites at each end of the exon. They join together to form a large structure called the spliceosome. They act only in the cytosol. They attach introns to exons in the correct order. Question 11 0.25 pts Which of the following types of mutation, resulting in an error in the mRNA...

  • 7. Open reading frames A protein coding gene includes the following sequence on one of its...

    7. Open reading frames A protein coding gene includes the following sequence on one of its two DNA strands. Note that this segment (within an exon) does NOT include either the start codon or the stop codon for this gene. However, because five of the six potential reading frames (3 on each DNA strand) in this region include stops, only the true reading frame remains "open" through this segment. Therefore, it is possible to unambiguously decode (translate) this segment of...

  • Please provide justifications for all answers so I understand. Extra detail is very helpful. Thank you...

    Please provide justifications for all answers so I understand. Extra detail is very helpful. Thank you so much. Question 1 [7pts] A. The following DNA sequence contains an open reading frame that codes for an 8 amino acid protein. Which open reading frame (1, 2 or 3) would need to be translated to yield that protein? (1pt) TAATGTATATCCCACGGTATGGAGTTTAAG B. In the frame you chose, give an example of a silent mutation at the third amino acid. (2pt) C. Now give...

  • Question 5 -- / 1 There are different amino acids, and possible codons. 1 3; 20...

    Question 5 -- / 1 There are different amino acids, and possible codons. 1 3; 20 2 3; 64 3 20; 3 4) 20; 64 5) 64; 3 6 64; 20 Question 6 -- / 1 Which of the following contains an open reading frame (consider the given strand only)? 1 AUGCCCGGGCGAGAC UAUGCGCAACCUGAG N 3 AAAUGAUGACCCAAA 4 UAUGCCGUCGUGAGG 5 UGAUUUCCCGGGCAA Which of the following is true? The initiator tRNA starts in the A site of the ribosome during translation initiation,...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT