Question

4. In the following sequence, we see a stop codon (in bold) followed by a start codon (Underlined) Assuming the cell is normal and is capable of carrying out translation, would this particular RNA fragment be translated (explain why or why not) (6 pts)? 5-AUCGAUAACUAUGCCCG..G ACGGAGCUAGCCCAAAAAAAAAAA-3 Concerning the RNA strand shown above, name three different proteins you might find attached to this RNA fragment and show where each might be attached (4 pts)
0 0
Add a comment Improve this question Transcribed image text
Answer #1

The AUG highlighted here will act as a new Start codon. This is because the sequence from 5' end upto the AUG is the 5'- untranslated region ( 5' UTR). This region is not translated but is required for further regulation of the translation process. The AUG highlighted is the start codon here. Secondly we must notice that the stop codon UAA although present is not in frame, meaning not following the triplet codon rule from the 5'end. The highlighted AUG is the first AUG from the 5' end so a probable start site.

3 proteins found attached to this mRNA would be

Ribosome on ribosome binding site ( found prior to the start codon), methionine t-RNA which will bind to codon AUG and start translation and 5' cap binding protein that protect the 5' cap from exonuclease activity in the cell.

Add a comment
Know the answer?
Add Answer to:
4. In the following sequence, we see a stop codon (in bold) followed by a start...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • ​5.1 the underlined bold TAC is an ATG on the other strand. Is this a start codon? why?

    5.1 the underlined bold TAC is an ATG on the other strand. Is this a start codon? why? 5.2. does the underlined bold ATG open an ORF? why? 5.3 which ATG seems to be a valid start codon? Copy the sequence into the answer box and make the start codon bold and underlined. Split the ORF portion into codons fone blank between codons, like this ATG CCC GGG.... Keep the font Courier to keep all symbols equal width. If the copying process...

  • 4) What happens when the ribosomal complex encounters a stop codon? Explain which, if any, tRNAs...

    4) What happens when the ribosomal complex encounters a stop codon? Explain which, if any, tRNAs or proteins are involved 5)If the following DNA strand was used as a template, what would the sequence of an RNA be? 5́ GTACCGTC 3́ 6) How does acetylation of the chromatin affect the translation of genes contained within? In other words, does acetylation allow or inhibit transcription, and how?

  • where does transcription begin 3. List the major types of RNA and include what they code...

    where does transcription begin 3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...

  • Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...

    Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...

  • C++: Translating mRNA sequence help Homework Description Codon 1 You are working in a bioinformatics lab...

    C++: Translating mRNA sequence help Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...

  • Thank you!! Question 50 1 pts The first start codon you see in the same sequence)...

    Thank you!! Question 50 1 pts The first start codon you see in the same sequence) is the one the ribosome uses to start translation Which reading frame, therefore, is the correct one? 5'ACUAGCAGGAGACGUAAGCGAUGUGCCAGAUGCGCAGUCACACAUAACUGCAAG 3' third fourth sixth fifth second first

  • Can anyone explain these answers step by step. Especially I do not know how to start...

    Can anyone explain these answers step by step. Especially I do not know how to start question 1 or two!!! Thank you! Work with a partner to complete the following questions. 1. Fill in the bases of the complementary DNA strand. 3-TATAATTACGCTAGATCACCCACT5 2. Transcribe the mRNA sequence using the bottom (3 to 5) strand as the template. What is the name of the sequence upstream of the gene that the RNA polymerase binds to? 3. 4. What polypeptide sequence would...

  • 1. How is the start codon identified in prokaryotic cells? a. It is the only AUG...

    1. How is the start codon identified in prokaryotic cells? a. It is the only AUG on the mRNA strand. b. It is the AUG after the Shine-Dalgarno sequence. c. It is the AUG right next to the promoter on the mRNA. d. It is the AUG after the Kozak sequence. e. It is the AUG nearest the 5' end of the mRNA. 2. All of the following are true for eukaryotic transcription EXCEPT: a. Transcription can be terminated when...

  • 2) On your first day working in my lab, you obtain the following DNA sequence: 3'...

    2) On your first day working in my lab, you obtain the following DNA sequence: 3' AATTATACACGATGAAGCTTGTGACAGGTTTCCAATCATTAA 5 5' TTAATATGTGCTACTTCGAACACTGTECCAAAGGTTAGTAATT 3' a) What are the two possible RNA molecules that could be transcribed from this DNA? Indicate the 5' and 3' ends of the RNA. b) Only one of these two RNA molecules can actually be translated. Explain why. c) It turns out that the RNA molecule that can be translated is the mRNA for p53. What is the amino...

  • Background Information How can we predict where a coding gene will be in bacteria? And can...

    Background Information How can we predict where a coding gene will be in bacteria? And can we then predict what protein will be produced? Take the DNA sequence below, for example. tcaggctttaattcatccgtgatctttgacgacggtaaatacgatgcagatataatacgatgaccgatgccaatcgaccgatcaaggaggcaccgaatggcgatgatggcgatgattgcgattaacgaagtggaacgcattatggcgggcattaacgaagatacccatgcgaccggcgaaaacgaaaccatttgcagctgcgcgaactttgaagaactgacccatgcgaccggccgcgaagcgacctaaaagtcgtaattacgtatcaagtcatgggccgcgggcgcccggcccactgactagactagggccgggcgcccgcggcccaccatataaataaaaaaaaaaaaaacgaggctatagctcatcaatgacct If you were a bacterial RNA polymerase, what sequence(s) should there be in this DNA for you to bind and begin transcribing? And if you found such sequence(s), where would you begin transcription? As a human being looking at this fragment of DNA, what type of consensus sequence(s)...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT