What is the predicted amino acid sequence encoded by Unknown_sequence_A? What process did you use to determine this?
Search for similar genes in other organisms. What other organisms have similar genes? Is there a similar gene in humans? How did you determine this?
Why might it be useful to use amino acid sequences to search for similar genes rather than DNA sequences directly?
>Unknown_sequence_A
ATGAGTTTTATTTTTAAATTTATTGCCACTTTTGTACGCAAAATGCTGGA
GCTGTTGCAATTTGGAGGGAAAACCCTTACGCACACGCTGAGTATTTATG
TAAAAACGAACACGGGCAAAACGCTGACCGTTAATCTGGAGCCCCAGTGG
GATATTAAAAACGTAAAGGAACTGGTGGCACCACAATTGGGACTTCAGCC
GGATGATCTAAAGATCATATTTGCCGGTAAGGAACTAAGCGATGCCACGA
CAATAGAGCAATGTGACTTGGGTCAGCAAAGCGTTTTGCATGCCATTCGT
TTGCGACCGCCCGTGCAGCGCCAGAAAATCCAGTCGGCCACTTTGGAGGA
GGAGGAACCTTCGCTTAGCGATGAAGCCTCCAAGCCTCTAAATGAAACTC
TGTTGGACTTGCAGCTGGAAAGCGAGGAGCGTCTGAATATAACCGATGAA
GAAAGAGTCCGTGCCAAAGCGCATTTCTTTGTACATTGCAGCCAATGCGA
TAAGCTGTGTAATGGCAAACTTCGGGTCCGCTGCGCTTTATGCAAGGGCG
GCGCCTTTACTGTCCATCGTGATCCGGAGTGTTGGGATGATGTCTTGAAG
TCGCGTAGAATTCCCGGTCATTGTGAAAGTCTGGAGGTGGCCTGCGTGGA
CAACGCGGCTGGCGATCCGCCCTTCGCTGAATTCTTCTTCAAGTGTGCTG
AGCATGTCTCCGGCGGGGAGAAGGATTTTGCGGCTCCATTGAATCTAATC
AAGAATAACATCAAGAATGTTCCTTGCCTGGCCTGCACGGATGTGAGTGA
TACCGTGTTGGTTTTCCCCTGCGCATCGCAGCACGTCACCTGTATCGACT
GCTTCCGCCATTATTGCCGTTCCCGTTTGGGCGAGCGTCAGTTTATGCCG
CATCCGGACTTCGGCTACACCTTGCCCTGTCCCGCAGGCTGCGAGCACTC
GTTCATCGAGGAGATTCATCACTTCAAGCTGTTGACACGCGAGGAGTACG
ATCGGTACCAGAGATTCGCCACCGAGGAGTATGTCCTACAGGCAGGTGGA
GTACTCTGCCCCCAGCCAGGATGCGGCATGGGCCTTTTGGTGGAGCCCGA
TTGTCGCAAGGTGACATGCCAGAACGGCTGTGGATACGTGTTCTGCCGCA
ATTGTCTGCAGGGCTACCATATCGGGGAGTGTCTGCCCGAGGGGACGGGC
GCCAGTGCCACAAACTCCTGCGAGTACACCGTGGACCCAAATCGAGCTGC
CGAGGCGCGATGGGATGAGGCCAGCAATGTCACCATCAAAGTCAGCACAA
AGCCCTGTCCAAAATGCAGAACCCCCACGGAGCGAGATGGCGGTTGCATG
CACATGGTCTGCACACGCGCTGGCTGCGGATTCGAGTGGTGCTGGGTCTG
CCAGACTGAGTGGACACGCGACTGCATGGGAGCCCACTGGTTCGGCTAA
Question
The predicted amino -acid sequence coded by the gene sequence is ubiquitin parkin protein.
Figure: Result of blastx
I use "blastx" program of NCBI to known the amini-acid sequence. This program take nucleotide sequence as input sequence , translate this sequence into amino-acid and compare with all amino acid sequence present in the databases.
This protein is found in other organism too. Like chimps etc, D.melanogaster. Yes, this gene present in human too. This result is received by using tool "ncbi blastn".
It is useful to use amino acid sequences to search for similar genes rather than DNA sequences directly because more than 1 codon could be use for coding same amino acid( degenrate codon). Therefore , even though two sequences might not be similar at nucleotide level but similar at amino-acid sequence level.
What is the predicted amino acid sequence encoded by Unknown_sequence_A? What process did you use to...
A gene point mutation that converts the sequence of the codon and therefore converts the encoded amino acid to a stop codon: missense mutation frameshift mutation silent mutation nonsense mutation A mouse gene was identified and determined to be required for formation of heart muscle. A gene with a similar sequence was identified in the human genome. What experiment could scientists do to determine if the mouse and human genes have similar functions? The scientist could place the mutant mouse...
Did I answer the mRNA sequences
and Amino acid sequences correctly? What types of mutations are
these? How do you do the bottom?
Part 3. Cystic Fibrosis Directions: Cystic Fibrosis is a disorder where the individuals have long and kidney problems. The disorder is caused by a mutation in one of the individual's genes. Complete the boxes below by finding the mRNA and amino acid sequence Compare the moutant DNA strands to the original strand. Circle the mutation in the...
How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met - Leu - Arg? Be sure to include a stop codon. Explain your answer! 5′ ...GGAGCUCGUUGUAUU... 3′ Is this sequence RNA or DNA? How can you tell? Which amino acids are encoded, if the reading frame is as shown, starting from the correct end? What would be the effect on the amino acid sequence if the sequence were changed to 5′ GGAGACUCGUUGUAUU 3′?...
If the amino acid sequences in homologous proteins of two organisms are similar, what can you conclude about the DNA of the two organisms?
a. If you knew the amino acid sequence of a peptide could you use that information to find the gene in a pool of genomic DNA. If so, how might you do this. b. How does a cell recognize which strand is the sense strand? How does the RNA polymerase enzyme actually know where to start making a message. How about stopping? (Detailed explanation please)
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA > Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence
acid amino in four changes in the eberal point mutations, resulting e encoded proteins. These changes are listed below: Position in iAlde Amino Acid Gly Met Amino Acid 176 235 266 268 Gly Leu Gly Ala The DNA sequence of the coding strand in the region which encodes amino adds 266 and 268 of the I and I alleles is shown below (differences shown in type): Sequence of I allele: Sequence of I allele: .ACTACATGGGGGCGTTCTT.. e) Based on the mutation...
8) You have extracted DNA from two different organisms. In the purification process, you find that the two test tubes have lost their identifying labels. The sequences of DNA are: Sample 1: TCC CTA TGC CCG AGG GAT ACG GGC Sample 2: CGA TCT TAA CCC GCT AGA ATT GGG The only other piece of information you have is the corresponding amino acid sequence of a particular protein for both organisms. Organism I has ala-arg-ile-gly and organism II has ala-arg-ile-pro....
8) You have extracted DNA from two different organisms. In the purification process, you find that the two test tubes have lost their identifying labels. The sequences of DNA are: Sample 1: TCC CTA TGC CCG ///// AGG GAT ACG GGC Sample 2: CGA TCT TAA CCC ///// GCT AGA ATT GGG The only other piece of information you have is the corresponding amino acid sequence of a particular protein for both organisms. Organism I has ala-arg-ile-gly and organism II...