Question

a. If you knew the amino acid sequence of a peptide could you use that information...

a. If you knew the amino acid sequence of a peptide could you use that information to find the gene in a pool of genomic DNA. If so, how might you do this.

b. How does a cell recognize which strand is the sense strand? How does the RNA polymerase enzyme actually know where to start making a message. How about stopping?

(Detailed explanation please)

0 0
Add a comment Improve this question Transcribed image text
Answer #1

ANS)

a)

--> The amino corrosive coded can tell the three base which together structure codon on mRNA to code for that specific amino corrosive. The mRNA succession would thus be able to help in realizing DNA arrangement by complementary to layout strand.

b)

-->The 3' end of layout strand have advertiser district which helps in acknowledgment of this site by RNA polymerase compound, the terminal region is available 5' downstream of format strand. The barrette GC and U is shaped in prokaryotes while in eukaryotes oligo arrangement polyadenylation and DNA restricting element are utilized for endonuclease action.

Add a comment
Know the answer?
Add Answer to:
a. If you knew the amino acid sequence of a peptide could you use that information...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • A peptide from a novel bacterial protein was isolated and sequenced. The amino acid sequence is...

    A peptide from a novel bacterial protein was isolated and sequenced. The amino acid sequence is NH2-Leu-Met-Pro-Tyr-Ser-Ala-Ala-Pro-Cys-Leu-Trp-Glu-Ala-Gly-Asp-Arg-COOH. To verify and clone the gene encoding this protein from this uncharacterized bacterium, a student has to purify the bacterial genomic DNA and use it as the template to isolate the DNA fragment that encodes this peptide using PCR. The student plans to design a pair of oligonucleotides as the forward and reverse primers to PCR the DNA fragment that encodes this peptide....

  • 1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The...

    1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The point mutation in the gene results in the MRNA sequence AUGCCGGACUUU. What are the amino acid sequence for the normal and mutant proteins? Say, with an explanation whether you expect this to be a silent mutation. b. Why is DNA polymerase said to be template-directed? If a RNA had the nucleotide sequence 5'-AUGCCAUAACGAUACCCCAGUC-3', what was the sequence of the DNA strand that was transcribed...

  • 15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would...

    15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would translate from the *GCACCAUGCAAAGCGGGGAUUAGACCUUU-3 Caution: from which end of the RNA strand does the ribosome begin translating? 3-AGAGUCCAUGCAAAGCGGGGAUUGUACCUUU - 5' 16. Determine the amino acid sequence a ribosome would translate from the following non template DNA strand. (Hint: you must first convert the non template DNA strand to a template DNA strand and then to mRNAJ 3'-ACCTTGATCCTTGACGTATGTAGTATGTATC-5'

  • Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands...

    Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...

  • based on the given graph how would these be answered? sa sequence from a sheep PCR...

    based on the given graph how would these be answered? sa sequence from a sheep PCR product. The template used was genomic DNA and the forward and se primers were designed to amplify partofthe priongene, which encodes the causative agentot scrapie. is black;Cisblue; Ais green: Tisred. The forward primerwasusedasasequencing primer. TheNattheten ow means that the computer can't decide which nucleotide is at that position in the sequence because there are two peaks (red=T and blue-C) that are the same height....

  • 28 29 30 31 32 33 28. Genes found in segments of chromosome called heterochromatin would...

    28 29 30 31 32 33 28. Genes found in segments of chromosome called heterochromatin would likely be expressed at high levels. expressed at low levels, or not at all. deleted before replication. maternally inherited only. none of these 29. (Use this representation to answer the following question.) DNA template strand 5 3' DNA complementary strand 3' 5' Using the double-stranded molecule above, in which direction does the RNA polymerase enzyme move? 3' → 5' along the template strand 5'...

  • You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce...

    You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...

  • 6.) Vitamin C is an essential dietary vitamin for us because we cannot make it in...

    6.) Vitamin C is an essential dietary vitamin for us because we cannot make it in our own bodies, the way that most animals can. This is because an important gene was inactivated by mutation in one of our ancestors millions of years ago. But vitamin C is not a protein. How can there be a gene to code for a molecule that is not a protein? (You may have to look some things up to answer this.) 7.) RNA...

  • Transcription is the process of rewriting DNA. DNA molecules are made from 4 different nucleotides which...

    Transcription is the process of rewriting DNA. DNA molecules are made from 4 different nucleotides which acts as building blocks. These building blocks are adenine, thymine, guanine and cytosine. When put together in different chemical combinations they become directions for the functions of the cell molecules which are primarily proteins. When a certain protein is needed, the RNA polymerase enzyme will find the gene for that particular protein and makes an RNA copy of it. DNA and RNA have similar...

  • Could you please provide me the answer for following multiple choice question- subject- Genes, Genomics and...

    Could you please provide me the answer for following multiple choice question- subject- Genes, Genomics and Human Health( Genetics) Question-2 Question 2.1 Whole genome DNA sequencing can be applied to genome-wide association studies to sequence the genomes of as many as 100,000 individuals search for rare Mendelian coding mutations search for very rare variants on haplotypes identified in genome-wide genotyping studies identify family pedigrees in large populations Question 2.2 Next Generation sequencing aims to sequence the genome to a coverage...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT