8. State the probable effect of the following changes to the indicated region of a gene or RNA molecule:
a) deletion of 5 bp at -10 region of an E. coli gene
b) deletion of 5 bp at -80 region of an E. coli gene
c) addition of the sequence “GCGCGGGCG” at -12 of an E. coli gene
A. -10 region of an E. coli gene is the promoter region. Deletion will effects transcription.
B. No effecton transcription.
3. Additon of GCGCGGGCG at -12 of an E. coli gene results in change of promoter sequence at -35 region. So transcription will be effected.
8. State the probable effect of the following changes to the indicated region of a gene...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
Question 8 (1 point) The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides long, but the mature mRNA that is translated on the ribosome is 1872 nucleotides long. This size difference occurs primarily as a result of: O addition of the poly A tail O removal of exons O splicing O addition of the 5' cap Question 7 (1 point) Which of the following recognizes the promoter region of a gene in E. coli allowing RNA polymerase...
Sigma-70 allows E. coli RNA polymerase to recognize: A. a -12 and -35 region upstream of the transcribed region of a gene B. a -12 and -24 region upstream of the transcribed region of a gene C. a -10 and -35 region upstream of the transcribed region of a gene D. a -10 and -35 region downstream of the transcribed region of a gene E. a -24 and -35 region upstream of the coding region of a gene
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
A cell that is heterozygous for a nonsense mutation in a tumor suppressor gene would most likely: A) Group of answer choices B) grow but not divide C) have a normal cell cycle D) arrest and induce apoptosis E) have a slightly increased cell cycle and increased cell growth F) grow and divide uncontrollably Which of the following correctly describes an event that occurs during transcription: Group of answer choices A) A DNA molecule is chemically modified to become a...
region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA sequence that encodes RNA and a o coding, barcoding o control, coding o noncoding, control o coding, control During transcription, the DNA template is read in the ___direction. o 3 to 5 oC to N terminal ON to C terminal 0 5' to 3' For genes encoding protein, which of the following is the eukaryotic consensus sequence of the promoter? ATAT o GCGC CGCG...
1. What transcript is produced from this gene?
5’ ATTGTGAGCAGGAAGAGAGT 3’
3’ TAACACTCGTCCTTCTCTCA 5’
A) 5’AUUGUGAGCAGGAAGAGAGU3’
B) 5’ACUCUCUUCCUGCUCACAAU3’
C) 5’UAACACUCGUCCUUCUCUCA3’
D) 5’UGAGAGAAGGACGAGUGUUA3’
2.If the anticodon is 5’CAU 3’, what codon on the mRNA will it
bind?
3.The lac operon is ON in which situation:
A) Low glucose low lactose
B) Low glucose high lactose
C) High glucose high lactose
D) High glucose low lactose
4.You have isolated an E. coli mutant that has a deletion of the
gene encoding the...
answer all the questions
1) All of the following contribute to promoter binding by RNA polymerase I in bacteria except: a)-10 consensus sequence b)-35 consensus sequence c) rho factor d) sigma factor e) none of the above 2) Common structural changes or lesions found in DNA after exposure to ultraviolet light are: a) thymine dimers b) cytosine dimers c) purine dimers d) adenine dimers e) none of the above 3) What is the function of the sigma subunit in the...
1 Which of the following represents one of the mechanisms by which antisense agents exert their effect? a. A short DNA sequence binds to specific regions of complementary mRNA, inducing a nuclease that promotes translation to the corresponding protein b. Antisense oligonucleotides prevent the natural silencing of targeted mRNA sequences C. A short DNA sequence binds to specific regions of complementary mRNA, inducing a nuclease that cleaves the mRNA d. Antisense oligonucleotides inhibit all types of gene splicing 2 The...
TranslationOverview:The purpose of this activity is to help the students to understand how replication, transcription, and translation are connected. Students will use a sequence from a bacterial gene that confers resistance to antibiotics (carbapenems). They will be asked to apply the knowledge obtained in the class lecture to (1) find the promoter in the sequence, (2) determine the amino acid sequence of a fragment of the polypeptide, (3) "reverse translate" a fragment of the polypeptide, and (4) identify mutations in...