Question

Mutations in several different proteins could cause a nuclear cargo protein to be mistakenly transported into the ER. Please
0 0
Add a comment Improve this question Transcribed image text
Answer #1

A.ERGIC53 PROTEIN

B.The ERGIC53 seems to serve as receptor for packaging some secretory protein into COPII-coated vesicles.Its role in protein transport was identified because human who lacks it owing to an inherited mutation have lowered serum levels of two secreted blood cloating factors (Factor 1\/ and \/111) and bleeding therefore execcively.

Add a comment
Know the answer?
Add Answer to:
Mutations in several different proteins could cause a nuclear cargo protein to be mistakenly transported into...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • What is protein X and what gene could be mutated to cause these results? Wild type...

    What is protein X and what gene could be mutated to cause these results? Wild type Mutant DNA Protein X DNA Protein X Compound Compound Untreated US Protein X is a nuclear hormone receptor. The mutation is in protein X and it no longer binds compound S. Protein X is a nuclear hormone receptor. The mutation is in protein X and increases its affinity for compound Protein X is NFAT. The mutation is in the GPCR that binds compound U...

  • In-Class Activity #12, Protein Tratlicking Worksheet 1. You are interested in four different proteins in a...

    In-Class Activity #12, Protein Tratlicking Worksheet 1. You are interested in four different proteins in a yeast cell: • protein 1 is a cytosolic protein protein 2 is a secreted protein • protein 3 is a nuclear protein protein 4 is a cell surface membrane protein with N-terminal end in extra-cellular space. a. You plan to study how the proteins are localized to their specific destination by creating the following mutations in the genes encoding proteins 1-4. Indicate how the...

  • V. (a). List the 3 proteins that are transported by the protein. For example: DNA polymerase, ribosomal protein, et...

    V. (a). List the 3 proteins that are transported by the protein. For example: DNA polymerase, ribosomal protein, etc.) for transpoet of proteins in eukaryotic cells. For each, give 2 examples of that mechanism. (Does not need to be specific protein ane. just the function of (b) What is the molecular mechanism that determines which of the above transport mechanisms is specific protein? nu iいUw Lili い used for a ve (c) Which type of protein does not use any...

  • please answer all 6 questions Question 27 3 pts TRBP is a protein important for the...

    please answer all 6 questions Question 27 3 pts TRBP is a protein important for the formation of the RISC complex. Which of the following would you expect in cells with null mutations in TRBP? o Reduced siRNA-mediated mRNA degradation o Increased miRNA-mediated translational repression o Increased deadenylase-mediated mRNA degradation o Reduced proteasome-mediated protein degradation D Question 28 3 pts A protein that binds to the 3' UTR of a VEGF mRNA and promotes deadenylation and uncapping is likely to:...

  • Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What...

    Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What do they have in common? (c) How are they different? 2. A geneticist found that a particular DNA mutation had no effect on the protein coded by a gene. What kind of mutation was this? Why? 3. (a) Name one amino acid that has more than one codon. (b) Name an amino acid that has only one codon 4. Look at the following sequence:...

  • Scientists want to design fluorescent marker proteins for different cellular compartments using the Green Fluorescent Protein...

    Scientists want to design fluorescent marker proteins for different cellular compartments using the Green Fluorescent Protein (GFP). This means that the GFP will be targeted and glow at the organelle of interest and they can use these to mark different organelles during fluorescence microscopy. To make these marker proteins, they take the sequence of GFP and add the desired sorting signal. A. GFP on its own is an excellent protein to use as an organelle marker protein because it is...

  • Please provide justifications for all answers so I understand. Extra detail is very helpful. Thank you...

    Please provide justifications for all answers so I understand. Extra detail is very helpful. Thank you so much. Question 1 [7pts] A. The following DNA sequence contains an open reading frame that codes for an 8 amino acid protein. Which open reading frame (1, 2 or 3) would need to be translated to yield that protein? (1pt) TAATGTATATCCCACGGTATGGAGTTTAAG B. In the frame you chose, give an example of a silent mutation at the third amino acid. (2pt) C. Now give...

  • Please answer as many as you can. Will rate!! Across 4. Type of protein that spans...

    Please answer as many as you can. Will rate!! Across 4. Type of protein that spans the entire membrane 5. One of the amino acid residues used to form O-linked glycoproteins. 7. Newly synthesized phospholipids are inserted into the _____ side of the smooth ER membrane. 8. Type of bond used to link membrane proteins to a membrane lipid 10. One of the sugars that can be added to phosphatidylinositol to make glycosylphosphatidylinosiol 12. Enzyme that joins fatty acids and...

  • BIOCHEMISTRY HELP ASAP PLEASE!!! Question 7 3 pts The transcription and production of a protein called...

    BIOCHEMISTRY HELP ASAP PLEASE!!! Question 7 3 pts The transcription and production of a protein called interferon-beta (FNB) is regulated VF-Blevel by a transcription factor called IRF3 which binds to DNA as a dimer of two 30KD Mutation monomeric proteins. The DNA-binding site of RF3 contains the following amino acids. Nere Arg - Lys - lle - Thr. I create four mutants of IRF3 by changing one of the amino acids of AD the DNA-binding site to serine, and then...

  • 6.) Provide short answers for the questions about protein structure below: a.) True or False, amino...

    6.) Provide short answers for the questions about protein structure below: a.) True or False, amino acid sequence defines the native structure of protein. b.) What is the main type of bonding responsible for stabilizing the secondary structure of proteins? c.) Briefly discuss the thermodynamics of protein folding into its native 3D structure. Is this process enthalpy driven or entropy driven? d.) Give an example of 2 major secondary structural motifs found in polypeptides. Do any of these motifs appear...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT