Homework Answers
2.
The single unit (monomer) os a nucleic acid is called a nucleotide. It is comprised of a sugar moiety, a phosphate group, and a nitrogenous base.
3.
A codon is a group of three Nucleotides that together, code for a particular amino acid, or function as the Translation stop codon.
4.
The Amino Acid is encoded for by the codons 'AAT' and 'AAC'. The structure of 5'-AAT-3' is:
Add Answer to:
2. What is a single unit or monomer of a nucleic acid called? 3. What is...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram...
14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram represents some of the puzzle piece pieces used in this section. a Assembled in this form, do they represent an amino acid, c. a portion of messenger RNA, or a deoxyribonucleotide (b) Explain your answer. Opo 3. Why is DNA often called a double helix? 4. State the following ratios. (a) Guanine to cytosine in a double-stranded DNA molecule: (b) Adenine to thymine: -...
A synthetic mRNA containing the monomer uridine monophosphate as the only monomer unit would result in...
A synthetic mRNA containing the monomer uridine monophosphate as the only monomer unit would result in a protein with: a. all kinds of amino acids, arranged at random b. only two kinds of amino acids, arranged alternately c. only two kinds of amino acids, arranged randomly d. only one kind of amino acid Which of the following best expresses the relationship between nucleic acid and protein in most organisms? DNA RNA Protein b. RNA DNA Protein c. Protein DNA RNA...
1. A is a unit of nucleic Select the appropriate term from the table below to...
1. A is a unit of nucleic
Select the appropriate term from the table below to complete eacALUlllllell. tRNA rRNA replication transcription translation DNA. deletion translocation frame shift nucleus a l. A Duckohde unit of nucleic acid containing a sugar attached to is a phosphate group and a base. 2. The site of transcription is the the ribosome moves along the mRNA. 3. In the process of 4. A class of RNA molecules which is linked directly with protein synthesis,...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
1 e and 2 e 1 need help on those. ive posted this multiple times and...
1 e
and 2 e 1 need help on those. ive posted this multiple times and
peolle have anawered . but both times i posted they have given me
two diff reaponses for the answers. please help for 1e and 2e. if u
coild look at the chart and decide the sequences for me
please be simple and clear
3rd base in codon puco sucopucobuco 2nd base in codon CAIG SS2288 222222233&a The Genetic Code 1st base in codon Norma...
please help ! What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG? Check...
please help !
What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG? Check Answer Use the codon table to answer the following questions: THE CODON TABLE SECOND POSITION FIRST POSITION THIRD POSITION 0000000000000000 What would be the second amino acid produced by the DNA strand TACCGA GTCACG (Hint: use the mRNA strand you already coded) Check Answer Value: 1 What would be the third amino acid produced by the DNA strand: TACCGAGTCACG (Hint: use the mRNA strand...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using...
INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3-A TTGCT TACTTGCA T-5° DNA 5 2) Does it matter which strand is the 'code strand'? The following two sequences look identical, except one runs 3-5' and the other 5'-3'....
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram represents some of the puzzle piece pieces used in this section. a Assembled in this form, do they represent an amino acid, c. a portion of messenger RNA, or a deoxyribonucleotide (b) Explain your answer. Opo 3. Why is DNA often called a double helix? 4. State the following ratios. (a) Guanine to cytosine in a double-stranded DNA molecule: (b) Adenine to thymine: -...
A synthetic mRNA containing the monomer uridine monophosphate as the only monomer unit would result in a protein with: a. all kinds of amino acids, arranged at random b. only two kinds of amino acids, arranged alternately c. only two kinds of amino acids, arranged randomly d. only one kind of amino acid Which of the following best expresses the relationship between nucleic acid and protein in most organisms? DNA RNA Protein b. RNA DNA Protein c. Protein DNA RNA...
1. A is a unit of nucleic
Select the appropriate term from the table below to complete eacALUlllllell. tRNA rRNA replication transcription translation DNA. deletion translocation frame shift nucleus a l. A Duckohde unit of nucleic acid containing a sugar attached to is a phosphate group and a base. 2. The site of transcription is the the ribosome moves along the mRNA. 3. In the process of 4. A class of RNA molecules which is linked directly with protein synthesis,...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
1 e
and 2 e 1 need help on those. ive posted this multiple times and
peolle have anawered . but both times i posted they have given me
two diff reaponses for the answers. please help for 1e and 2e. if u
coild look at the chart and decide the sequences for me
please be simple and clear
3rd base in codon puco sucopucobuco 2nd base in codon CAIG SS2288 222222233&a The Genetic Code 1st base in codon Norma...
please help !
What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG? Check Answer Use the codon table to answer the following questions: THE CODON TABLE SECOND POSITION FIRST POSITION THIRD POSITION 0000000000000000 What would be the second amino acid produced by the DNA strand TACCGA GTCACG (Hint: use the mRNA strand you already coded) Check Answer Value: 1 What would be the third amino acid produced by the DNA strand: TACCGAGTCACG (Hint: use the mRNA strand...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3-A TTGCT TACTTGCA T-5° DNA 5 2) Does it matter which strand is the 'code strand'? The following two sequences look identical, except one runs 3-5' and the other 5'-3'....
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago