Question

+ Which sequence length (150 or 265 base pairs) better represents variation in the entire genome? Why?
0 0
Add a comment Improve this question Transcribed image text
Answer #1

265 bp sequence length better represents variation in the entire genome.

Explanation: Higher genome size associated with complexity of animals.The genome is made up of sequences of four nucleotide bases: Adenine, Guanine, Cytosine and Thymine.This GC bond gives more stability to the DNA structure.

Human DNA contains more repetitive DNA which Repetative DNA are necessary to format expression of unique coding sequence and to organise additional functions essential for genome replication and accurate transmission to progeny cells. Repetitive DNA sequence elements are also fundamental to the cooperative molecular interactions forming nucleoprotein complexes. Long DNA sequence contains more repetitive DNA. Thus it associated with variation.

Add a comment
Know the answer?
Add Answer to:
+ Which sequence length (150 or 265 base pairs) better represents variation in the entire genome?...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 1. The genome of organism A consists of approximately 2.184 ×109 base pairs, and DNA synthesis...

    1. The genome of organism A consists of approximately 2.184 ×109 base pairs, and DNA synthesis occurs at a rate of 500 base pairs per second. How many minutes would it take to synthesize the entire genome of organism A, if there were only one origin of replication? 2. It turns out that organism A is actually able to synthesize its entire 2.184 ×109 bp genome in only 35 minutes. How many origins of replication must there be? 3. The...

  • You found a bacterium that has a genome of 2 millions base pairs. How long is...

    You found a bacterium that has a genome of 2 millions base pairs. How long is the stretch of 16S rDNA that you want to sequence to make sure that you can know what specific species it is? You will first assume that there is no history in biology and then you will say in which direction the length of the DNA stretch (bigger or smaller) if you suppose that all bacterial species have evolved from a common ancestor. *

  • You found a bacterium that has a genome of 2 millions base pairs. How long is...

    You found a bacterium that has a genome of 2 millions base pairs. How long is the stretch of 16S rDNA that you want to sequence to make sure that you can know what specific species it is? You will first assume that there is no history in biology and then you will say in which direction the length of the DNA stretch (bigger or smaller) if you suppose that all bacterial species have evolved from a common ancestor.

  • Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to...

    Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). 5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3' 3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5' a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the...

  • The diagram below represents a polypeptide with multiple signal sequences. Which signal sequence will the SRP...

    The diagram below represents a polypeptide with multiple signal sequences. Which signal sequence will the SRP recognize to initiate translocation in the ER? Why? Sketch the arrangement of the protein in the ER membrane. The diagram below represents a polypeptide with multiple signal sequences. Which signal sequence will the SRP recognize to initiate translocation in the ER? Why? Sketch the arrangement of the protein in the ER membrane.

  • Q1) What is the size of the entire pOTC-Δ plasmid (in units of base pairs, bp)?...

    Q1) What is the size of the entire pOTC-Δ plasmid (in units of base pairs, bp)? Simply input one NUMBER with no spaces, punctuation or units. Make sure you write the number in digits not words (1 mark) Q2) What are the selection markers for the pOTC-Δ plasmid? (1 mark) Select one: a. Hygromycin resistance gene b. NdeI c. NdeI and KpnI d. Ampicillin resistance gene e. Ampicillin resistance gene and the hygromycin resistance gene f. pUC Ori and OTC-Δ...

  • 5. Using HSAB theory, choose the better acid or base in the following pairs and explain your choice: a. CH3NH2 or NH...

    5. Using HSAB theory, choose the better acid or base in the following pairs and explain your choice: a. CH3NH2 or NH3 in reaction with H b. Which end of SCN will coordinate to Cr3+: Pt2+? c. Boric acid, B(OH)3, acts as an acid in water, but does not do so via ionization of a proton. Rather, it serves as a Lewis acid towards OH-. Explain with the use of a balanced equation.

  • The VNTR locus D17S539 has a repeat length of 5 base pairs. Individuals may have from...

    The VNTR locus D17S539 has a repeat length of 5 base pairs. Individuals may have from 2 to 50 repeats. The individuals listed below know the sizes of their alleles. Label the gel below to identify which sample was run in each lane. Jennifer: 128bp, 128bp Mandy: 48bp, 200bp, Kathy: 80bp, 300bp Name Name Name Answer (bp) Answer (bp) Answer (bp) Answer (bp) Answer (bp)

  • Which of the following represents a palindrome sequence? ACCTTCCA ATTCCAAT GATTAATC GGTAATCC NONE OF THE ABOVE...

    Which of the following represents a palindrome sequence? ACCTTCCA ATTCCAAT GATTAATC GGTAATCC NONE OF THE ABOVE WHICH OF THE FOLLOWING WHENPAIRED WITH its complementary strand have the highest t_as? Base slacking, or the "stacking interaction," is most likely the result of which monovalent interaction charge-dipole interaction dipole-dipole interaction dipole-induced dipole interaction van der Waals interaction none of the above Which of the following formulas would be a carbohydrate C_5H_12O_5 C_4H_5O_6 C_6H_19O_6 C_3H_8O_3 C_6H_12O_6 Dihydroxy acetone (Shown below) is classified as...

  • Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dyst...

    Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT