Homework Answers
Consensus sequence is the order of most frequent nucleotide or protein residues in sequence alignment.
Consensus sequence: AGCAATT
Add Answer to:
b. Consider the nucleotide sequences in the table. AGGAGTT 2 AGCTATT 3 TGCAATA ACGAAAA 5 ТССТААТ...
The six nucleotides preceding the start codon and the first nucleotide after the start codon in...
The six nucleotides preceding the start codon and the first nucleotide after the start codon in eukaryotes exhibit strong sequence preference as determined by the percentages of nucleotides in the -6 to -1 positions and the +4 position. Use the data given in the table to determine the six nucleotides that most commonly precede the start in vertebrates. Express your answer as a sequence of nucleotides separated by dashes. Example: 5'-C-A-T-G-...-3' Use the data given in the table to determine...
Below are reported nucleotide sequences for an intron in the same gene for 4 different species...
Below are reported nucleotide sequences for an intron in the same gene for 4 different species of animals. Report the differences you've observed between the nucleotide sequences of the different species in the matrix below. B C D Use the differences in your matrix to create a rooted tree topology showing the evolutionary relationships between creatures A, B, C, & D. Write your topology out on the chart below. Work from right to left: the chart is nicely lined out...
Question 7 of 7 Map deb A pling Given mRNA sequences, provide the amino acid sequences,...
Question 7 of 7 Map deb A pling Given mRNA sequences, provide the amino acid sequences, using the three-letter designations, for which they code. A link to a table of codons can be found here a) m RN A: 5-CCGCACGGAUAU-3' amino acid sequence: b) mRNA: 5-GGCAACGAGCUC-3' amino acid sequence: c) mRNA: 5'-CAACGUAAUC GA-3' amino acid sequence: Hint O Previous ® Give Up & View Solution 2 Answer Next Ext Check
2. (15 marks) Consider the abstract datatype SEQ whose objects are sequences of elements and whic...
do (b) please
2. (15 marks) Consider the abstract datatype SEQ whose objects are sequences of elements and which supports two operations . PREPEND(x, S), which inserts element r at the beginning of the sequence S and . ACCESS(S, i), which returns the ith element in the sequence Suppose that we represent S by a singly linked list. Then PREPEND(, S) takes 1 step and ACCESS(S, i) takes i steps, provided S has at least i elements Suppose that S...
2. A single nucleotide addition and a single nucleotide deletion approximately 15 base pairs apart in...
2. A single nucleotide addition and a single nucleotide deletion approximately 15 base pairs apart in the DNA cause a protein change in sequence friom Old Phe-Ser-Pro-Arg-Leu-Asn-Ala-Val-Lys to ne Phe-Val-His-Ala-Leu-Met-Ala-Val-Lys a. What are the old and new mRNA nucleotide sequences? Old 5' uu Au b. Which nucleotide has been added? Which has been deleted?
the following is region of an eukaryotic mRNA: 5’-ACGCGCCUUCACACAGGAACAGCUAUGGCCAUGAGCACGCCAGUCUCGGCA UUAUCCUAUUAAAGGGAACUGAGGUGA-3’ A. Somewhere near the 5’ end is...
the following is region of an eukaryotic mRNA: 5’-ACGCGCCUUCACACAGGAACAGCUAUGGCCAUGAGCACGCCAGUCUCGGCA UUAUCCUAUUAAAGGGAACUGAGGUGA-3’ A. Somewhere near the 5’ end is the Kozak consensus sequence. Using the given genetic code table, what would be the first 7 amino acid residues of this protein? Indicate polarity. B. How would the protein change due to the following mutation on the mRNA (be very specific and completewith your answers): The deletion of nucleotide at position 22 (italicized)? The G nucleotide at position 27 (italicized) is changed from a C?...
The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as...
The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as well as the type of single nucleotide mutation that produced each mutant polypeptide. Peptide sequence Type of mutation Wild type Met - Leu - Arg - Ile - ... Mutant 1 Met - Leu - Arg - Met -... transition Mutant 2 Met - Leu - [STOP] transition Mutant 3 Met - Phe - Arg - lle - ... transversion Determine the mRNA sequence...
please make sure the answer is CORRECT ! Consider the sequences 3 [n] 0 1 2...
please make sure the answer is CORRECT !
Consider the sequences 3 [n] 0 1 2 230 -7-6-5-4-3 -2 1 -20 -30 What sequence y[n] implies the relation x[n]* y[n] = z[n]? у т . Ayon] Del в 4-3-proizne - What sequence coincides with (n-u[n]* S[n - 2]? on.u[n - 2] (n - 2)-u[n] (n – 2):u[n - 3] None of the above What is the impulse response of the following system? AD→D→D→D peppepp。 ppeece -10 1 23456789_n 1 -1...
Prove that the number of unordered sequences of length k with elements from a set X...
Prove that the number of unordered sequences of length k with elements from a set X of size n is n+k−1 k . Hint: For illustration, first consider the example n = 4, k = 6. Let the 4 elements of the set X be denoted a, b, c, d. Argue that any unordered sequence of size 6 consisting of elements a, b, c, d can be represented uniquely by a symbol similar to “··|·|··|·”, corresponding to the sequence aabccd....
2. The sequences of 13 promoters recognized by σ70 factor of RNA polymerase have been aligned...
2. The sequences of 13 promoters recognized by σ70 factor of RNA
polymerase have been aligned below. Deduce the consensus sequences
for the -10 and -35 regions of these promoters. The TSS is
highlighted. Do your consensus sequences agree with the actual
consensus sequences? If not, why?
Gene 1: TCTCAACGTAACACTTTACAGCGGCG--CGTCATTTGATATGATGC-GCCCCGCTTCCCGATAAGGG Gene 2: GATCAAAAAAATACTTGTGCAAAAAA--TTGGGATCCCTATAATGCGCCTCCGTTGAGACGACAACG Gene 3: ATGCATTTTTCCGCTTGTCTTCCTGA--GCCGACTCCCTATAATGCGCCTCCATCGACACGGCGGAT Gene 4: CCTCAAATTCAGGGTTGACTCTGAAA--GAGGAAAGCGTAATATAC-GCCACCTCGCGACAGTGAGC Gene 5: CTGCAATTTTTCTATTGCGGCCTGCG--GAGAACTCCCTATAATGCGCCTCCATCGACACGGCGGAT Gene 6: TTTTAAATTTCCTCTTGTCAGGCCGG--AATAACTCCCTATAATGCGCCACCACTGACACGGAACAA Gene 7: GCAAAAATAAATGCTTGACTCTGTAG--CGGGAAGGCGTATTATGC-ACACCCCGCGCCGCTGAGAA Gene 8: TAACACCGTGCGTGTTGACTATTTTA-CCTCTGGCGGTGATAATGG--TTGCATGTACTAAGGAGGT Gene 9: TATCTCTGGCGGTGTTGACATAAATA-CCACTGGCGGTGATACTGA--GCACATCAGCAGGACGCAC Gene 10: GTGAAACAAAACGGTTGACAACATGA-AGTAAACACGGTACGATGT-ACCACATGAAACGACAGTGA Gene 11: TATCAAAAAGAGTATTGACTTAAAGT-CTAACCTATAGGATACTTA-CAGCCATCGAGAGGGACACG...
The six nucleotides preceding the start codon and the first nucleotide after the start codon in eukaryotes exhibit strong sequence preference as determined by the percentages of nucleotides in the -6 to -1 positions and the +4 position. Use the data given in the table to determine the six nucleotides that most commonly precede the start in vertebrates. Express your answer as a sequence of nucleotides separated by dashes. Example: 5'-C-A-T-G-...-3' Use the data given in the table to determine...
Below are reported nucleotide sequences for an intron in the same gene for 4 different species of animals. Report the differences you've observed between the nucleotide sequences of the different species in the matrix below. B C D Use the differences in your matrix to create a rooted tree topology showing the evolutionary relationships between creatures A, B, C, & D. Write your topology out on the chart below. Work from right to left: the chart is nicely lined out...
Question 7 of 7 Map deb A pling Given mRNA sequences, provide the amino acid sequences, using the three-letter designations, for which they code. A link to a table of codons can be found here a) m RN A: 5-CCGCACGGAUAU-3' amino acid sequence: b) mRNA: 5-GGCAACGAGCUC-3' amino acid sequence: c) mRNA: 5'-CAACGUAAUC GA-3' amino acid sequence: Hint O Previous ® Give Up & View Solution 2 Answer Next Ext Check
do (b) please
2. (15 marks) Consider the abstract datatype SEQ whose objects are sequences of elements and which supports two operations . PREPEND(x, S), which inserts element r at the beginning of the sequence S and . ACCESS(S, i), which returns the ith element in the sequence Suppose that we represent S by a singly linked list. Then PREPEND(, S) takes 1 step and ACCESS(S, i) takes i steps, provided S has at least i elements Suppose that S...
2. A single nucleotide addition and a single nucleotide deletion approximately 15 base pairs apart in the DNA cause a protein change in sequence friom Old Phe-Ser-Pro-Arg-Leu-Asn-Ala-Val-Lys to ne Phe-Val-His-Ala-Leu-Met-Ala-Val-Lys a. What are the old and new mRNA nucleotide sequences? Old 5' uu Au b. Which nucleotide has been added? Which has been deleted?
The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as well as the type of single nucleotide mutation that produced each mutant polypeptide. Peptide sequence Type of mutation Wild type Met - Leu - Arg - Ile - ... Mutant 1 Met - Leu - Arg - Met -... transition Mutant 2 Met - Leu - [STOP] transition Mutant 3 Met - Phe - Arg - lle - ... transversion Determine the mRNA sequence...
please make sure the answer is CORRECT !
Consider the sequences 3 [n] 0 1 2 230 -7-6-5-4-3 -2 1 -20 -30 What sequence y[n] implies the relation x[n]* y[n] = z[n]? у т . Ayon] Del в 4-3-proizne - What sequence coincides with (n-u[n]* S[n - 2]? on.u[n - 2] (n - 2)-u[n] (n – 2):u[n - 3] None of the above What is the impulse response of the following system? AD→D→D→D peppepp。 ppeece -10 1 23456789_n 1 -1...
2. The sequences of 13 promoters recognized by σ70 factor of RNA
polymerase have been aligned below. Deduce the consensus sequences
for the -10 and -35 regions of these promoters. The TSS is
highlighted. Do your consensus sequences agree with the actual
consensus sequences? If not, why?
Gene 1: TCTCAACGTAACACTTTACAGCGGCG--CGTCATTTGATATGATGC-GCCCCGCTTCCCGATAAGGG Gene 2: GATCAAAAAAATACTTGTGCAAAAAA--TTGGGATCCCTATAATGCGCCTCCGTTGAGACGACAACG Gene 3: ATGCATTTTTCCGCTTGTCTTCCTGA--GCCGACTCCCTATAATGCGCCTCCATCGACACGGCGGAT Gene 4: CCTCAAATTCAGGGTTGACTCTGAAA--GAGGAAAGCGTAATATAC-GCCACCTCGCGACAGTGAGC Gene 5: CTGCAATTTTTCTATTGCGGCCTGCG--GAGAACTCCCTATAATGCGCCTCCATCGACACGGCGGAT Gene 6: TTTTAAATTTCCTCTTGTCAGGCCGG--AATAACTCCCTATAATGCGCCACCACTGACACGGAACAA Gene 7: GCAAAAATAAATGCTTGACTCTGTAG--CGGGAAGGCGTATTATGC-ACACCCCGCGCCGCTGAGAA Gene 8: TAACACCGTGCGTGTTGACTATTTTA-CCTCTGGCGGTGATAATGG--TTGCATGTACTAAGGAGGT Gene 9: TATCTCTGGCGGTGTTGACATAAATA-CCACTGGCGGTGATACTGA--GCACATCAGCAGGACGCAC Gene 10: GTGAAACAAAACGGTTGACAACATGA-AGTAAACACGGTACGATGT-ACCACATGAAACGACAGTGA Gene 11: TATCAAAAAGAGTATTGACTTAAAGT-CTAACCTATAGGATACTTA-CAGCCATCGAGAGGGACACG...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago