
The photo above is instructions from my professor.
the question asks:
The final step of the cloning procedure is to screen the plasmid library for clones that carry the vgp gene, shown in red below.
To accomplish the screening, researchers synthesize a single-stranded DNA probe using vgp mRNA as a template. What will be the sequence of nucleotides in the probe?
Drag the labels to their appropriate locations in the probe. Labels can be used once, more than once, or not at all
lastly this is the photo and the answers I have tried:


![vОР яеме лhетт, Алттс .слът етап) Абуля – 2 теб ди(ТАСТТА - - 4тсА САст] eттe4s mRNA sequence. 5. AUGAAUUC... CAGU GUGA 1 D](http://img.homeworklib.com/questions/f1e60220-ffd7-11eb-a04d-b142007780ba.png?x-oss-process=image/resize,w_560)
The photo above is instructions from my professor. the question asks: The final step of the...
The final step of the cloning procedure is to screen the plasmid library for clones that carry the vgp gene, shown in red below.To accomplish the screening, researchers synthesize a single-stranded DNA probe using vgp mRNA as a template. What will be the sequence of nucleotides in theprobe?Drag the labels to their appropriate locations in the probe. Labels can be used once, more than once, or not at all.
How Do I determine DNA sequence? (My answer is wrong). I will only give full
points for this question if it's fully explained.
Part D - Screening the plasmid libraryThe final step of the cloning procedure is to screen the plasmid library for clones that carry the vgp gene. shown in red below. To accomplish the screening, researchers synthesize a single-stranded DNA probe using vgp mRNA as a template. What will be the sequence of nucleotides in the probe? Drag...
I have my own answers, i just want to check my work,
thanks!
Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...
PLEASE HELP WITH TABLE.thank you
1.Select the coding strand, and select the template strand from
the answers below. (Select more than 1 answer)
The coding strand is the first strand running from 5' to 3'.
The coding strand is the second strand running from 3' to
5'.
The template strand is the second strand running from 3' to
5'.
The template strand is the first strand running from 5' to
3'.
2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3-A TTGCT TACTTGCA T-5° DNA 5 2) Does it matter which strand is the 'code strand'? The following two sequences look identical, except one runs 3-5' and the other 5'-3'....
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features of a "gene have been left out of this segment (eg promoter, terminator). Assume that the direction of movement of the RNA polymerase is from right to left (draw this on a piece of paper so that you can see it S ATAQOCATTCCATACCCAAS AGOTATGGGTT-T True or False The TOP strand serves as the template strand that you can see it) QUESTION / Consider the...
Question 16: The following shows the same segment of DNA that was shown above in Question 15, however, this DNA sequence is for the mutant allele for the collagen type 1 gene. This mutated allele is responsible for a genetic skeletal disorder called osteogenesis imperfecta. 5' ATGCTATGGGCATGATCCCAGCCT 3' 3' TACGATACCCGTACTAGGGTCGGA 5' Answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence for this mutant allele? The mutated mRNA...
Name: Section Transcription Worksheet (5 Points) Instructions: Below is the same DNA molecule from above. Now, it is preparing Renes in this region. Using pencil draw in and label the following items according cule from above. Now, it is preparing for transcription of the and label the following items according to the instructions. 1) Label template and non-template strands 2) Label 5' and 3' ends of template and non-template strand 3) Draw in and label RNA polymerase 4) Label transcription...