1. What can you predict about the location of core promoter sequences and polyadenylation cut sites in the genomic sequence of a gene with multiple transcription start and termination sites?
The polyadenylation sequences and core promoter sequences are usually controlled by cis elements which are present near upstream and downstreamm regions. If coding genes are more then polyadneylation sequences are also more in number.
1. What can you predict about the location of core promoter sequences and polyadenylation cut sites...
6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures and tutorial manual and listed below. Prokaryotis operon promoter (-10 and -35 elements), operator, multiple structural renes (for example 3), start site of transcription, start sites of translations, transcription termination sequence Prokaryotic mRNA (polycistronie): transcription start site, multiple ribosome binding sites The Shine-Dalgamo sequence in Ecoli), multiple ORFs (including start and stop codons). transcription termination sequence Eukaryotic genes promoter (TATA box), consensus sequence CAAT,...
Can someone please help me answer these questions. Thank
you!
Eukaryotic transcription signals
a) This drawing shows the placements of the four main sequences of
the eukaryotic core promoter for RNA polymerase II. Identify each
one and give a brief explanation
b) Which sequences are used in a DPE-driven promoter?
c) Which ones are used in a TATA-driven promoter?
d) Please draw and describe the steps as the transcription factors
work with eukaryotic RNA polymerase II to start transcription of...
Hello! I am working on this genetics problem and was wondering if
these two answers would make sense. Thank you for the help!
Question 1 (1 point) Saved Why can bacteria have poly-cistronic genes? Because they need multiple cistron organelles so they segregate evenly during cell division. Because they have many exons that are joined together before translation Because ribosomes can be loaded at multiple Shine Delgano/AUG sequences. Because ribosomes are loaded at the single CAP site. Because the stability...
Draw a typical prokaryotic gene with its promoter and terminator. Draw the primary transcript Label (using letters) all the parts (including sites of consensus sequences) in both the gene and the mRNA. Indicate what the ‘letters stand for. (Use the line drawing below). What proteins are involved in transcription initiation, elongation and termination in prokaryotic genes. +1 5’ ________________________________________________________________ 3’ 3’ ________________________________________________________________ 5’
hello, two of these circled answers are incorrect.
1 6. The promoter sequences are the positions that: signal the initiation site of a gene (+1) B) bind the transcriptional factor that is associated with RNA polymerase e) attach the correct nucleotide triphosphate to the template DNA strand D) separate the two DNA strands CUA 7. A particular triplet of bases in the coding sequence of DNA is GAT. The anticodon on the tRNA that binds the mRNA codon is A...
one
correct answer
Question 12 (1 point) What are the trans acting factors that control transcription in bacterial genes? O cap, start codon, stop codon. enhancers, silencers, operator, promoter, polyadenylation signal. 5 prime end of RNA, GU-splice site, branch point-A, AG-splice site, polyadenylation signal. O repressors, activators, cap, start codon, stop codon. O promoters, GU-splice site, branch point-A, AG-splice site, polyadenylation signal. enhancers, silencers, promoters, polyadenylation signal. repressors, activators. attenuators, Shine-Dalgarno sequence, start codon, stop codon attenuators, activator binding site,...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
Can you identify all the component of gene expression (regulatory sequences, operator, promoter, repressor, activator coding, noncoding, sequences)? I need an explanation of what each component does in a gene expression.
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
Copy of Shown below is a plasmid containing several labeled sequences. Multi-cloning site (CS) Transcription terminator Promoter TATA box original replication a) Based on the sequences it contains, is this plasmid intended for gene expression in eukaryotes or prokaryotes? How do you know? (3 pts) b) Based on your answer to part A, describe the promoter & terminator regions in a little more detail. What is a consensus sequence you would expect in the promoter? And what sorts of sequences...