Question

In sequencing, it is key that all primer molecules hybridize to the exact same 3’ base...

In sequencing, it is key that all primer molecules hybridize to the exact same 3’ base on the template. Why?
0 0
Add a comment Improve this question Transcribed image text
Answer #1

The primer molecules are the short oligonucleotides RNA sequences that provides an existing nucleotide sequence for the DNA polymerase to initiate polymerization. The replication always occur in the direction of 5'-3' direction. So, the primer molecule binds to the 5'-end of the template, with the complimentary 3'-end of the primer.

Therefore, the direction of the template is 5'-3' and the direction of primer is 3'-5'.

When the primer molecules hybridize to the template, the enzyme DNA polymerase begins the polymerization.

Hope it helps, Good luck !!!!!

PLEASE DO PRESS LIKE :)

Add a comment
Know the answer?
Add Answer to:
In sequencing, it is key that all primer molecules hybridize to the exact same 3’ base...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The following primer sequence was used in a Sanger sequencing reaction along with the following template,...

    The following primer sequence was used in a Sanger sequencing reaction along with the following template, how many different products would be expected if the only dideoxynucleotide being used was ddTTP? Primer:            5’ TGGCGCGC 3’ Template:       5’ TGGCGCGCATGGTTTAGCGCGCCA 3’ a. 6 b. 5 c. 4 d. 3 e. 2

  • THANK YOU!! Target Region Heated to 94°C DNA is denatured GGGCAACGTG CATCACTTTG Primers hybridize with template...

    THANK YOU!! Target Region Heated to 94°C DNA is denatured GGGCAACGTG CATCACTTTG Primers hybridize with template Temperature is lowered After one round of PCR the number of double-stranded DNA molecules is doubled. TGG TCACTTTGGCAAIAGAATT Heat-stable DNA polymerase adds nucleotides to the 3' end of the primer Primer 1 Primer 2 Heated to 72°C 5 TGCCTGGCCCCATCACTTTGGCAA AGAATTC 5

  • The following strand of DNA is to be used for sequencing: 3'CGACTGACTCGACGGCCTAGCTATAG. The primer is CTGACTG....

    The following strand of DNA is to be used for sequencing: 3'CGACTGACTCGACGGCCTAGCTATAG. The primer is CTGACTG. The number of DNA fragments resulting from a tube containing all the normal deoxyribonucleotides along with dideoxyCTP added is expected to be: 06 05 08

  • POST-LAB #9 - DNA Barcoding: Animal Phylogeny Building by Sequencing (20pts) Directions: Using the key provided,...

    POST-LAB #9 - DNA Barcoding: Animal Phylogeny Building by Sequencing (20pts) Directions: Using the key provided, interpret the nucleotide base sequences in the four electropherograms below. Write each base below its KEY corresponding peak. - 2pts And memes 1. Wallet 2 banan sam hesalesanan Amalan 3. 4. 12 V Α' Α' Aav po e te AL А. ab x *² ADA Style 5. Are the sequences above identical to the DNA Template? Why or why not? -1pt

  • 3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned...

    3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing method. Below is the DNA sequence from a region of the vector. 5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’ 3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’ To which DNA strand does the primer bind, the top or bottom one? Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band)...

  • A scientist is doing a classical Sanger sequencing reaction. He sets up four reaction tubes, labeling...

    A scientist is doing a classical Sanger sequencing reaction. He sets up four reaction tubes, labeling them G, A, T, and C. To each tube he adds template, DNA polymerase, buffer, primer, all four dNTPs, and accidently, small amounts of all four ddNTPs. He then runs his samples on a sequencing gel. What do you think the gel will look like? The G, A, T, and C lanes will all look like normal, and it will still be easy to...

  • 3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut...

    3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...

  • Sanger sequencing allows the identification of the bases and their order in a target piece of...

    Sanger sequencing allows the identification of the bases and their order in a target piece of DNA. This technique exploits the way DNA is transcribed by using a primer and allowing new DNA to be created from its 3' end. In this technique, DNA is manufactured in vitro, which means that enzymes and molecules are combined in a test tube to allow the reactions to occur. In the original technique, four tubes were prepared, each containing the same reactants, but...

  • Using the key provided (in the first photo on the right hand side) interpret the nucleotide...

    Using the key provided (in the first photo on the right hand side) interpret the nucleotide base sequences in the gour electropherograms below. Write each base below its corresponding peak. Also, are the sequences above idential to the DNA template? Why or why not? POST-LAB #9 - DNA Barcoding: Animal Phylogeny Building by Sequencing (20pts) Directions: Using the key provided, interpret the nucleotide base sequences in the four electropherograms below. Write each base below its corresponding peak. - 2pts KEY...

  • 1) You have four tubes with buffer, primer, DNA polymerase, template, and dNTP’s. In tube A,...

    1) You have four tubes with buffer, primer, DNA polymerase, template, and dNTP’s. In tube A, you have added radioactive ddATP at a ratio of 1 ddATP/100 dATP. In tube T, you have added radioactive ddTTP at a ratio of 1 ddTTP/100 dTTP. In tube G, you have added radioactive ddGTP at a ratio of 1 ddGTP/100 dGTP. In tube C, you have added radioactive ddCTP at a ratio of 1 ddCTP/100 dCTP. Here is a picture of the template...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT