A putative gene is the segment of the DNA whose protein product and its function are not known. The putative gene can be identified by an open reading frame (ORF). An ORF is a coding region of protein. It contains an initiation codon ATG (AUG in case of RNA); termination codons like TAA, TGA and TAG. The putative gene may contains atleast 6 reading frames of which three are oriented in one direction and other three in reverse direction.
A double stranded DNA segment with 6 reading frames.
List at least 3 components that a particular sequence of DNA must have in order to...
The difficulty with PCR cloning is that enough DNA sequence must be known to synthesize the primers to bracket a target gene. Name two potential sources of DNA sequence information for a target gene.
PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The primers must attach to separated DNA at the target sequences so that the polymerase can build new DNA strands. What must also be added to the mixture besides primers and polymerase enzyme in order to get amplification and DNA? a. RNA polymerase b. dNTPs c. electron carriers d. DNA repair enzymes
PDX-1 must bind to DNA in order to function. A particular arrangement of amino acids with polar r-groups determines the sequence of nitrogenous bases the PDX-1 can bind to via hydrogen bonds; however, a separate binding pocket of the protein helps it attach to the DNA backbone. What would you predict the characteristics of those amino acids are? Positively Charged Polar Uncharged Negatively Charged Nonpolar
QUESTION 8 List the components used in PCR versus the components used in qPCR. QUESTION 1 Which of the following is not valid about how Primers work for PCR Having a sequence that anneals in the range of 56°C to 60°C depending upon design. Having the same sequence as the 'template DNA' in the gene of interest, about 20-30bp in length. Using sequences that are as close to 50% GC vs AT as possible. Using a sequence complementary to the...
1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It is 249 bp long, and is suspected to be a serine protease inhibitor ATGAGCAGCGGCGGCCTGCTGCTGCTGCTGGGCCTGCTGACCTTTTGCGCGGAACTGACC CCGGTGAGCAGCCGCAAACGCCATCCGTATTGCAACCTGCCGCCGGATCCGGGCCCGTGC CATGATAACAAATTTGCGTTTTATCATCATCCGGCGAGCAACAAATGCAAAGAATTTGTG TATGGCGGCTGCGGCGGCAACGATAACCGCTTTAAAACCCGCAACAAATGCCAGTGCACC TGCAGCGGC a) Which sequencing method would you use to sequence a gene in this size range, and why? (Name of technique and 1-2 sentence explanation.) b) What technique would you use to amplify the DNA, in order to make more of it for future experiments? (What is...
Benefit Options - list the top 3 benefits you must have in order to be with an employer and why they are make or break components. Do you think this is reasonable to expect? How flexible are you with these components?
You characterize the sequence of a full-length cDNA and the corresponding genomic DNA for a particular intron-containing gene from mouse cells. When you align them to each other using a computer program, the exons of the cDNA align perfectly in some regions with pieces of the genomic DNA, whereas other exons appear to have a small number of specific nucleotide differences compared to the genomic DNA. Assume this genomic DNA and cDNA come from the same individual, and there are...
4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This gene has only one exon meaning no sequence is spliced out during RNA processing. a) What will be the amino acid sequence this gene codes for? 15 points will be given for a completely correct amino acid sequence. You can get partial points if: the beginning of the amino acid sequence is correct (at least two first amino acids, 4 points), and/or the end...
In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers (5’ ACTGA 3’) are added to a test tube. A template strand of DNA is shown below. How many fragments of different lengths would you have at the end of the sequencing process? (write down the sequence of each fragment and the length of the fragment for full credit) DNA Sequence 3’ TGACTCTAGCCTAGGACTATATCG 5’
9. In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers (5' ACTGA 3') are added to a test tube. A template strand of DNA is shown below. How many fragments of different lengths would you have at the end of the sequencing process? (write down the sequence of each fragment and the length of the fragment for full credit)- 2.5pts DNA Sequence 3'TGACTCTAGCCTAGGACTATATCG 5'